Incidental Mutation 'R7538:Kcna2'
ID583695
Institutional Source Beutler Lab
Gene Symbol Kcna2
Ensembl Gene ENSMUSG00000040724
Gene Namepotassium voltage-gated channel, shaker-related subfamily, member 2
SynonymsMk-2, Akr6a4, Kca1-2, Kv1.2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7538 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location107101146-107115005 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107104568 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 155 (Y155C)
Ref Sequence ENSEMBL: ENSMUSP00000041702 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038695] [ENSMUST00000196403] [ENSMUST00000197470]
Predicted Effect probably benign
Transcript: ENSMUST00000038695
AA Change: Y155C

PolyPhen 2 Score 0.305 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000041702
Gene: ENSMUSG00000040724
AA Change: Y155C

DomainStartEndE-ValueType
BTB 33 133 1.2e-9 SMART
Pfam:Ion_trans 162 421 6.2e-53 PFAM
Pfam:Ion_trans_2 329 414 4.9e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196403
AA Change: Y155C

PolyPhen 2 Score 0.305 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000142873
Gene: ENSMUSG00000040724
AA Change: Y155C

DomainStartEndE-ValueType
BTB 33 133 1.2e-9 SMART
low complexity region 164 179 N/A INTRINSIC
Pfam:Ion_trans 224 409 1.3e-36 PFAM
Pfam:Ion_trans_2 329 414 7.9e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197470
AA Change: Y155C

PolyPhen 2 Score 0.305 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000143798
Gene: ENSMUSG00000040724
AA Change: Y155C

DomainStartEndE-ValueType
BTB 33 133 1.2e-9 SMART
Pfam:Ion_trans 162 421 6.2e-53 PFAM
Pfam:Ion_trans_2 329 414 4.9e-16 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (77/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member contains six membrane-spanning domains with a shaker-type repeat in the fourth segment. It belongs to the delayed rectifier class, members of which allow nerve cells to efficiently repolarize following an action potential. The coding region of this gene is intronless, and the gene is clustered with genes KCNA3 and KCNA10 on chromosome 1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit postnatal lethality, increased susceptibility to spontaneous and chemically-induced seizures and altered neuron electrophysiology. Mice homozygous for an ENU-induced allele exhibit abnormal gait, impaired coordination, and premature lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts8 C A 9: 30,953,470 P419H probably damaging Het
Adgra3 C T 5: 49,961,450 V919I probably benign Het
Akap12 G A 10: 4,353,213 V113I probably damaging Het
Akr1d1 T A 6: 37,536,108 I113K probably benign Het
Alx3 A T 3: 107,604,364 I230F probably damaging Het
Apob A T 12: 8,002,219 D1220V probably damaging Het
Ascc3 T C 10: 50,845,700 L2083P probably damaging Het
Atp10b A G 11: 43,225,546 I907V probably benign Het
B4galnt3 G T 6: 120,294,423 S46* probably null Het
Bfsp1 A C 2: 143,831,835 probably null Het
Cant1 G A 11: 118,411,465 R9W possibly damaging Het
Ccdc88a A T 11: 29,463,370 H636L probably benign Het
Cfi G A 3: 129,858,815 R297H probably benign Het
Cherp T A 8: 72,462,419 Q749L Het
Clec10a A G 11: 70,169,778 D153G probably benign Het
Cnga1 T C 5: 72,612,380 K99E probably benign Het
Cyp2r1 A T 7: 114,562,767 V64D probably damaging Het
Dact3 T A 7: 16,875,518 W32R probably damaging Het
Dennd4c T C 4: 86,774,516 C88R probably damaging Het
Dock8 A T 19: 25,158,418 D1200V probably damaging Het
Drosha C G 15: 12,926,243 S1262W probably damaging Het
Dtnb T C 12: 3,773,611 M592T possibly damaging Het
Eef2k T A 7: 120,891,992 V567E probably benign Het
Fem1b A G 9: 62,811,167 S47P probably damaging Het
Fryl T C 5: 73,022,676 E2864G probably benign Het
Fscn2 A G 11: 120,367,326 N358S possibly damaging Het
Fsip2 T C 2: 82,988,550 S4876P possibly damaging Het
Ggh C G 4: 20,049,833 S88C probably damaging Het
Grhl2 T C 15: 37,328,359 Y410H probably damaging Het
Gucy2c C T 6: 136,709,744 G831D probably damaging Het
Hars A T 18: 36,771,141 D228E probably benign Het
Hdhd5 T C 6: 120,521,296 D114G possibly damaging Het
Klc1 A G 12: 111,785,445 K441R probably benign Het
Kmt2a A G 9: 44,847,744 L936P probably damaging Het
Map3k6 T C 4: 133,251,927 V1197A probably benign Het
Mthfsd C T 8: 121,098,786 A349T probably benign Het
Mtmr7 G A 8: 40,597,384 R123W probably damaging Het
Muc16 T A 9: 18,642,131 I4289F probably benign Het
Muc16 G A 9: 18,655,451 T1924I unknown Het
Mybpc3 A C 2: 91,120,487 D220A probably damaging Het
Neb A T 2: 52,256,575 probably null Het
Nectin2 A G 7: 19,730,619 W287R probably damaging Het
Nipsnap1 A T 11: 4,884,089 T114S probably damaging Het
Nol9 T C 4: 152,039,658 S102P probably benign Het
Olfml2b A T 1: 170,649,833 K179I possibly damaging Het
Olfr1253 G T 2: 89,752,321 P169H probably damaging Het
Pcnt T C 10: 76,399,939 M1403V probably benign Het
Phf7 T C 14: 31,238,429 D284G probably benign Het
Pias3 A G 3: 96,702,218 T319A possibly damaging Het
Pik3ip1 A T 11: 3,333,558 I189F probably damaging Het
Pik3r1 T A 13: 101,689,406 T371S probably damaging Het
Prmt7 A G 8: 106,237,386 D304G probably benign Het
Prpf6 T C 2: 181,652,455 V818A probably benign Het
Pstpip2 A G 18: 77,871,605 E185G probably damaging Het
Ptprz1 T G 6: 22,999,896 F662V possibly damaging Het
Rasgrp3 T C 17: 75,496,416 F70L probably benign Het
Rcor1 A T 12: 111,067,837 probably null Het
Rnasel A G 1: 153,754,560 K274R probably benign Het
Rsbn1l G A 5: 20,896,457 T695I probably benign Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Het
Sema3a T C 5: 13,561,820 V351A probably benign Het
Serpina12 A G 12: 104,038,328 L15P unknown Het
Siah1a G A 8: 86,725,212 R215C probably benign Het
Sin3a T A 9: 57,103,926 V489D possibly damaging Het
Slc22a17 A G 14: 54,912,118 I208T probably benign Het
Slc36a4 G A 9: 15,734,215 V313M possibly damaging Het
Sod1 T A 16: 90,226,226 L145* probably null Het
Svep1 T C 4: 58,053,260 N3362D possibly damaging Het
Taf4b T C 18: 14,813,545 L475P probably damaging Het
Telo2 G T 17: 25,110,821 T239K probably benign Het
Trmt11 T G 10: 30,560,874 D290A probably damaging Het
Trpc4 A T 3: 54,318,095 D955V possibly damaging Het
Trpv6 T C 6: 41,626,167 N257S probably benign Het
Usp12 T C 5: 146,794,620 T15A probably benign Het
Vars2 G T 17: 35,660,780 Q526K probably damaging Het
Vipas39 A G 12: 87,263,903 probably null Het
Zfp689 A T 7: 127,444,838 C207S probably damaging Het
Zfpl1 C A 19: 6,084,402 E18* probably null Het
Other mutations in Kcna2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Kcna2 APN 3 107104630 missense probably damaging 1.00
IGL00711:Kcna2 APN 3 107104753 missense probably benign
IGL02380:Kcna2 APN 3 107104958 missense probably benign 0.00
grim UTSW 3 107105027 missense probably damaging 1.00
IGL03097:Kcna2 UTSW 3 107105399 missense probably benign 0.02
R0117:Kcna2 UTSW 3 107105354 missense probably damaging 1.00
R0200:Kcna2 UTSW 3 107105160 missense probably benign
R0463:Kcna2 UTSW 3 107105160 missense probably benign
R0472:Kcna2 UTSW 3 107105516 missense probably benign
R0662:Kcna2 UTSW 3 107105401 missense probably benign
R0746:Kcna2 UTSW 3 107105168 missense probably benign
R1838:Kcna2 UTSW 3 107104512 missense probably benign
R1847:Kcna2 UTSW 3 107105113 missense possibly damaging 0.54
R1912:Kcna2 UTSW 3 107105401 missense probably benign
R1966:Kcna2 UTSW 3 107104630 missense probably damaging 1.00
R1971:Kcna2 UTSW 3 107104824 missense probably damaging 1.00
R2419:Kcna2 UTSW 3 107104153 missense probably benign 0.21
R3796:Kcna2 UTSW 3 107105590 missense probably benign 0.37
R3830:Kcna2 UTSW 3 107104796 missense probably benign 0.04
R4273:Kcna2 UTSW 3 107105193 missense probably benign 0.00
R4570:Kcna2 UTSW 3 107104795 missense probably benign
R4662:Kcna2 UTSW 3 107105417 missense probably benign
R4756:Kcna2 UTSW 3 107105417 missense probably benign
R5054:Kcna2 UTSW 3 107104340 missense probably damaging 1.00
R5069:Kcna2 UTSW 3 107104637 missense probably damaging 1.00
R5070:Kcna2 UTSW 3 107104637 missense probably damaging 1.00
R5126:Kcna2 UTSW 3 107104234 missense probably damaging 1.00
R5146:Kcna2 UTSW 3 107105498 missense probably benign 0.00
R5205:Kcna2 UTSW 3 107097146 unclassified probably benign
R5472:Kcna2 UTSW 3 107105309 missense possibly damaging 0.93
R6687:Kcna2 UTSW 3 107105027 missense probably damaging 1.00
R6689:Kcna2 UTSW 3 107105027 missense probably damaging 1.00
R7216:Kcna2 UTSW 3 107104793 missense probably damaging 0.99
R7304:Kcna2 UTSW 3 107104750 missense probably benign
R7585:Kcna2 UTSW 3 107105342 missense probably damaging 1.00
R7968:Kcna2 UTSW 3 107105144 missense possibly damaging 0.79
R8241:Kcna2 UTSW 3 107105022 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGATCGCAACCGCCCTAG -3'
(R):5'- CCCGATGGTGCTGTTGGAATAG -3'

Sequencing Primer
(F):5'- ACTACTATCAGTCTGGGGGCAG -3'
(R):5'- TTGGAATAGGTGTGGAAGGTCAC -3'
Posted On2019-10-17