Incidental Mutation 'R7538:Muc16'
ID583727
Institutional Source Beutler Lab
Gene Symbol Muc16
Ensembl Gene ENSMUSG00000109564
Gene Namemucin 16
Synonyms1110008I14Rik, LOC385009
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock #R7538 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location18495455-18674530 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 18642131 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 4289 (I4289F)
Ref Sequence ENSEMBL: ENSMUSP00000147104 (fasta)
Predicted Effect probably benign
Transcript: ENSMUST00000208663
AA Change: I4289F

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice are viable and fertile with no gross histological abnormalities. Homozygous male mice father larger litters when crossed to wild-type females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts8 C A 9: 30,953,470 P419H probably damaging Het
Adgra3 C T 5: 49,961,450 V919I probably benign Het
Akap12 G A 10: 4,353,213 V113I probably damaging Het
Akr1d1 T A 6: 37,536,108 I113K probably benign Het
Alx3 A T 3: 107,604,364 I230F probably damaging Het
Apob A T 12: 8,002,219 D1220V probably damaging Het
Ascc3 T C 10: 50,845,700 L2083P probably damaging Het
Atp10b A G 11: 43,225,546 I907V probably benign Het
B4galnt3 G T 6: 120,294,423 S46* probably null Het
Bfsp1 A C 2: 143,831,835 probably null Het
Cant1 G A 11: 118,411,465 R9W possibly damaging Het
Ccdc88a A T 11: 29,463,370 H636L probably benign Het
Cfi G A 3: 129,858,815 R297H probably benign Het
Cherp T A 8: 72,462,419 Q749L Het
Clec10a A G 11: 70,169,778 D153G probably benign Het
Cnga1 T C 5: 72,612,380 K99E probably benign Het
Cyp2r1 A T 7: 114,562,767 V64D probably damaging Het
Dact3 T A 7: 16,875,518 W32R probably damaging Het
Dennd4c T C 4: 86,774,516 C88R probably damaging Het
Dock8 A T 19: 25,158,418 D1200V probably damaging Het
Drosha C G 15: 12,926,243 S1262W probably damaging Het
Dtnb T C 12: 3,773,611 M592T possibly damaging Het
Eef2k T A 7: 120,891,992 V567E probably benign Het
Fem1b A G 9: 62,811,167 S47P probably damaging Het
Fryl T C 5: 73,022,676 E2864G probably benign Het
Fscn2 A G 11: 120,367,326 N358S possibly damaging Het
Fsip2 T C 2: 82,988,550 S4876P possibly damaging Het
Ggh C G 4: 20,049,833 S88C probably damaging Het
Grhl2 T C 15: 37,328,359 Y410H probably damaging Het
Gucy2c C T 6: 136,709,744 G831D probably damaging Het
Hars A T 18: 36,771,141 D228E probably benign Het
Hdhd5 T C 6: 120,521,296 D114G possibly damaging Het
Kcna2 A G 3: 107,104,568 Y155C probably benign Het
Klc1 A G 12: 111,785,445 K441R probably benign Het
Kmt2a A G 9: 44,847,744 L936P probably damaging Het
Map3k6 T C 4: 133,251,927 V1197A probably benign Het
Mthfsd C T 8: 121,098,786 A349T probably benign Het
Mtmr7 G A 8: 40,597,384 R123W probably damaging Het
Mybpc3 A C 2: 91,120,487 D220A probably damaging Het
Neb A T 2: 52,256,575 probably null Het
Nectin2 A G 7: 19,730,619 W287R probably damaging Het
Nipsnap1 A T 11: 4,884,089 T114S probably damaging Het
Nol9 T C 4: 152,039,658 S102P probably benign Het
Olfml2b A T 1: 170,649,833 K179I possibly damaging Het
Olfr1253 G T 2: 89,752,321 P169H probably damaging Het
Pcnt T C 10: 76,399,939 M1403V probably benign Het
Phf7 T C 14: 31,238,429 D284G probably benign Het
Pias3 A G 3: 96,702,218 T319A possibly damaging Het
Pik3ip1 A T 11: 3,333,558 I189F probably damaging Het
Pik3r1 T A 13: 101,689,406 T371S probably damaging Het
Prmt7 A G 8: 106,237,386 D304G probably benign Het
Prpf6 T C 2: 181,652,455 V818A probably benign Het
Pstpip2 A G 18: 77,871,605 E185G probably damaging Het
Ptprz1 T G 6: 22,999,896 F662V possibly damaging Het
Rasgrp3 T C 17: 75,496,416 F70L probably benign Het
Rcor1 A T 12: 111,067,837 probably null Het
Rnasel A G 1: 153,754,560 K274R probably benign Het
Rsbn1l G A 5: 20,896,457 T695I probably benign Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Het
Sema3a T C 5: 13,561,820 V351A probably benign Het
Serpina12 A G 12: 104,038,328 L15P unknown Het
Siah1a G A 8: 86,725,212 R215C probably benign Het
Sin3a T A 9: 57,103,926 V489D possibly damaging Het
Slc22a17 A G 14: 54,912,118 I208T probably benign Het
Slc36a4 G A 9: 15,734,215 V313M possibly damaging Het
Sod1 T A 16: 90,226,226 L145* probably null Het
Svep1 T C 4: 58,053,260 N3362D possibly damaging Het
Taf4b T C 18: 14,813,545 L475P probably damaging Het
Telo2 G T 17: 25,110,821 T239K probably benign Het
Trmt11 T G 10: 30,560,874 D290A probably damaging Het
Trpc4 A T 3: 54,318,095 D955V possibly damaging Het
Trpv6 T C 6: 41,626,167 N257S probably benign Het
Usp12 T C 5: 146,794,620 T15A probably benign Het
Vars2 G T 17: 35,660,780 Q526K probably damaging Het
Vipas39 A G 12: 87,263,903 probably null Het
Zfp689 A T 7: 127,444,838 C207S probably damaging Het
Zfpl1 C A 19: 6,084,402 E18* probably null Het
Other mutations in Muc16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01330:Muc16 APN 9 18508507 missense possibly damaging 0.89
IGL01878:Muc16 APN 9 18495543 missense possibly damaging 0.90
IGL02394:Muc16 APN 9 18498700 missense probably damaging 0.99
IGL02553:Muc16 APN 9 18498553 critical splice donor site probably null
R0400:Muc16 UTSW 9 18510534 missense possibly damaging 0.74
R1620:Muc16 UTSW 9 18510477 missense possibly damaging 0.89
R1695:Muc16 UTSW 9 18497433 missense probably damaging 1.00
R3196:Muc16 UTSW 9 18497830 missense probably damaging 1.00
R5982:Muc16 UTSW 9 18647146 missense unknown
R5990:Muc16 UTSW 9 18659243 missense unknown
R6024:Muc16 UTSW 9 18646671 missense unknown
R6026:Muc16 UTSW 9 18659858 missense unknown
R6028:Muc16 UTSW 9 18657176 missense unknown
R6083:Muc16 UTSW 9 18657212 missense unknown
R6089:Muc16 UTSW 9 18643252 missense unknown
R6109:Muc16 UTSW 9 18655359 missense unknown
R6127:Muc16 UTSW 9 18657878 missense unknown
R6130:Muc16 UTSW 9 18590698 missense probably damaging 1.00
R6146:Muc16 UTSW 9 18497797 missense probably damaging 0.98
R6161:Muc16 UTSW 9 18647818 missense unknown
R6164:Muc16 UTSW 9 18558379 missense probably damaging 1.00
R6185:Muc16 UTSW 9 18654473 missense unknown
R6192:Muc16 UTSW 9 18658689 missense unknown
R6217:Muc16 UTSW 9 18655446 missense unknown
R6232:Muc16 UTSW 9 18656998 missense unknown
R6246:Muc16 UTSW 9 18577067 intron probably null
R6255:Muc16 UTSW 9 18655599 missense unknown
R6280:Muc16 UTSW 9 18579317 critical splice donor site probably null
R6286:Muc16 UTSW 9 18644389 missense unknown
R6287:Muc16 UTSW 9 18659034 missense unknown
R6307:Muc16 UTSW 9 18647588 missense unknown
R6310:Muc16 UTSW 9 18641950 missense probably benign 0.00
R6316:Muc16 UTSW 9 18641819 missense probably benign 0.01
R6335:Muc16 UTSW 9 18660708 missense unknown
R6345:Muc16 UTSW 9 18654926 missense unknown
R6349:Muc16 UTSW 9 18657329 missense unknown
R6366:Muc16 UTSW 9 18646044 missense unknown
R6393:Muc16 UTSW 9 18647399 nonsense probably null
R6440:Muc16 UTSW 9 18641359 missense probably benign 0.01
R6458:Muc16 UTSW 9 18641721 missense probably benign 0.01
R6460:Muc16 UTSW 9 18640516 missense probably benign 0.01
R6481:Muc16 UTSW 9 18550677 critical splice donor site probably null
R6539:Muc16 UTSW 9 18637325 missense probably benign 0.25
R6551:Muc16 UTSW 9 18562562 missense possibly damaging 0.95
R6596:Muc16 UTSW 9 18566715 missense probably benign 0.18
R6601:Muc16 UTSW 9 18637570 missense probably benign 0.10
R6602:Muc16 UTSW 9 18609476 intron probably null
R6615:Muc16 UTSW 9 18647188 missense unknown
R6625:Muc16 UTSW 9 18660278 missense unknown
R6668:Muc16 UTSW 9 18640385 missense probably benign 0.03
R6697:Muc16 UTSW 9 18641291 missense probably benign 0.01
R6710:Muc16 UTSW 9 18642070 missense possibly damaging 0.95
R6727:Muc16 UTSW 9 18566690 critical splice donor site probably null
R6789:Muc16 UTSW 9 18559986 missense probably benign 0.40
R6806:Muc16 UTSW 9 18537910 critical splice donor site probably null
R6874:Muc16 UTSW 9 18658769 nonsense probably null
R6894:Muc16 UTSW 9 18495576 missense possibly damaging 0.92
R6913:Muc16 UTSW 9 18642663 missense unknown
R6919:Muc16 UTSW 9 18660299 missense unknown
R6939:Muc16 UTSW 9 18638537 missense probably benign 0.04
R6953:Muc16 UTSW 9 18640529 missense probably benign 0.01
R6956:Muc16 UTSW 9 18645026 missense unknown
R6977:Muc16 UTSW 9 18645337 missense unknown
R6996:Muc16 UTSW 9 18645897 missense unknown
R7011:Muc16 UTSW 9 18637451 missense probably benign 0.26
R7011:Muc16 UTSW 9 18637543 missense probably benign 0.10
R7012:Muc16 UTSW 9 18495618 critical splice acceptor site probably null
R7014:Muc16 UTSW 9 18658236 missense unknown
R7021:Muc16 UTSW 9 18554919 missense unknown
R7021:Muc16 UTSW 9 18550831 splice site probably null
R7038:Muc16 UTSW 9 18620468 missense probably damaging 0.99
R7057:Muc16 UTSW 9 18646079 missense unknown
R7058:Muc16 UTSW 9 18639755 missense probably benign 0.10
R7066:Muc16 UTSW 9 18658021 missense unknown
R7067:Muc16 UTSW 9 18658251 missense unknown
R7070:Muc16 UTSW 9 18645923 nonsense probably null
R7074:Muc16 UTSW 9 18655650 missense unknown
R7085:Muc16 UTSW 9 18644849 missense unknown
R7088:Muc16 UTSW 9 18592680 missense probably damaging 0.99
R7107:Muc16 UTSW 9 18637298 missense probably benign 0.10
R7108:Muc16 UTSW 9 18655233 missense unknown
R7126:Muc16 UTSW 9 18641216 missense probably benign 0.01
R7128:Muc16 UTSW 9 18643004 missense unknown
R7145:Muc16 UTSW 9 18655580 missense unknown
R7179:Muc16 UTSW 9 18642008 missense probably benign 0.00
R7194:Muc16 UTSW 9 18674454 missense unknown
R7211:Muc16 UTSW 9 18498570 missense probably damaging 1.00
R7213:Muc16 UTSW 9 18641416 missense probably benign 0.01
R7217:Muc16 UTSW 9 18644076 nonsense probably null
R7221:Muc16 UTSW 9 18642199 missense probably benign 0.04
R7265:Muc16 UTSW 9 18656472 missense unknown
R7326:Muc16 UTSW 9 18585013 missense probably benign 0.03
R7359:Muc16 UTSW 9 18643020 missense unknown
R7387:Muc16 UTSW 9 18641720 missense probably benign 0.01
R7391:Muc16 UTSW 9 18639536 missense probably benign 0.04
R7398:Muc16 UTSW 9 18637742 missense possibly damaging 0.46
R7419:Muc16 UTSW 9 18641962 missense probably benign 0.01
R7431:Muc16 UTSW 9 18607993 missense
R7484:Muc16 UTSW 9 18646768 missense unknown
R7487:Muc16 UTSW 9 18584799 missense possibly damaging 0.93
R7497:Muc16 UTSW 9 18645089 missense unknown
R7515:Muc16 UTSW 9 18639662 missense probably benign 0.00
R7537:Muc16 UTSW 9 18638135 missense probably benign 0.06
R7538:Muc16 UTSW 9 18655451 missense unknown
R7543:Muc16 UTSW 9 18644732 missense unknown
R7566:Muc16 UTSW 9 18638629 missense probably benign 0.00
R7581:Muc16 UTSW 9 18645614 missense unknown
R7594:Muc16 UTSW 9 18645062 missense unknown
R7629:Muc16 UTSW 9 18566785 missense possibly damaging 0.86
R7664:Muc16 UTSW 9 18607722 missense probably benign 0.08
R7666:Muc16 UTSW 9 18558427 missense probably damaging 1.00
R7703:Muc16 UTSW 9 18605282 missense
R7727:Muc16 UTSW 9 18660242 missense unknown
Predicted Primers PCR Primer
(F):5'- CCAGAGCTAGAGACCAGTGATG -3'
(R):5'- AGATCACCCATGCTGGAGAAC -3'

Sequencing Primer
(F):5'- GAGACCAGTGATGGCATATTTTC -3'
(R):5'- GAGAACAGCCCAGCTTATCTGTG -3'
Posted On2019-10-17