Incidental Mutation 'R7538:Pcnt'
ID583736
Institutional Source Beutler Lab
Gene Symbol Pcnt
Ensembl Gene ENSMUSG00000001151
Gene Namepericentrin (kendrin)
Synonymsm239Asp, m275Asp, Pcnt2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7538 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location76351263-76442786 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 76399939 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 1403 (M1403V)
Ref Sequence ENSEMBL: ENSMUSP00000151534 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001179] [ENSMUST00000217838]
Predicted Effect probably benign
Transcript: ENSMUST00000001179
AA Change: M1403V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000001179
Gene: ENSMUSG00000001151
AA Change: M1403V

DomainStartEndE-ValueType
internal_repeat_1 7 78 2.47e-5 PROSPERO
low complexity region 104 114 N/A INTRINSIC
coiled coil region 131 229 N/A INTRINSIC
internal_repeat_3 241 259 6.69e-5 PROSPERO
low complexity region 313 325 N/A INTRINSIC
internal_repeat_3 391 409 6.69e-5 PROSPERO
low complexity region 456 467 N/A INTRINSIC
coiled coil region 468 520 N/A INTRINSIC
coiled coil region 554 581 N/A INTRINSIC
low complexity region 652 666 N/A INTRINSIC
coiled coil region 727 787 N/A INTRINSIC
coiled coil region 871 916 N/A INTRINSIC
low complexity region 931 942 N/A INTRINSIC
low complexity region 969 985 N/A INTRINSIC
coiled coil region 1055 1383 N/A INTRINSIC
coiled coil region 1429 1481 N/A INTRINSIC
coiled coil region 1529 1567 N/A INTRINSIC
low complexity region 1614 1624 N/A INTRINSIC
internal_repeat_2 1916 1964 2.47e-5 PROSPERO
coiled coil region 2158 2178 N/A INTRINSIC
coiled coil region 2211 2279 N/A INTRINSIC
coiled coil region 2300 2421 N/A INTRINSIC
coiled coil region 2447 2526 N/A INTRINSIC
Pfam:PACT_coil_coil 2718 2797 5.8e-29 PFAM
internal_repeat_1 2820 2885 2.47e-5 PROSPERO
internal_repeat_2 2844 2891 2.47e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000217838
AA Change: M1403V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (77/79)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele display mitotic spindle misorientation, microcephaly, craniofacial developmental anomalies, such as cleft palate and eye defects, variable structural kidney and cardiovascular defects, and altered hemodynamics leading to heart failure and prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts8 C A 9: 30,953,470 P419H probably damaging Het
Adgra3 C T 5: 49,961,450 V919I probably benign Het
Akap12 G A 10: 4,353,213 V113I probably damaging Het
Akr1d1 T A 6: 37,536,108 I113K probably benign Het
Alx3 A T 3: 107,604,364 I230F probably damaging Het
Apob A T 12: 8,002,219 D1220V probably damaging Het
Ascc3 T C 10: 50,845,700 L2083P probably damaging Het
Atp10b A G 11: 43,225,546 I907V probably benign Het
B4galnt3 G T 6: 120,294,423 S46* probably null Het
Bfsp1 A C 2: 143,831,835 probably null Het
Cant1 G A 11: 118,411,465 R9W possibly damaging Het
Ccdc88a A T 11: 29,463,370 H636L probably benign Het
Cfi G A 3: 129,858,815 R297H probably benign Het
Cherp T A 8: 72,462,419 Q749L Het
Clec10a A G 11: 70,169,778 D153G probably benign Het
Cnga1 T C 5: 72,612,380 K99E probably benign Het
Cyp2r1 A T 7: 114,562,767 V64D probably damaging Het
Dact3 T A 7: 16,875,518 W32R probably damaging Het
Dennd4c T C 4: 86,774,516 C88R probably damaging Het
Dock8 A T 19: 25,158,418 D1200V probably damaging Het
Drosha C G 15: 12,926,243 S1262W probably damaging Het
Dtnb T C 12: 3,773,611 M592T possibly damaging Het
Eef2k T A 7: 120,891,992 V567E probably benign Het
Fem1b A G 9: 62,811,167 S47P probably damaging Het
Fryl T C 5: 73,022,676 E2864G probably benign Het
Fscn2 A G 11: 120,367,326 N358S possibly damaging Het
Fsip2 T C 2: 82,988,550 S4876P possibly damaging Het
Ggh C G 4: 20,049,833 S88C probably damaging Het
Grhl2 T C 15: 37,328,359 Y410H probably damaging Het
Gucy2c C T 6: 136,709,744 G831D probably damaging Het
Hars A T 18: 36,771,141 D228E probably benign Het
Hdhd5 T C 6: 120,521,296 D114G possibly damaging Het
Kcna2 A G 3: 107,104,568 Y155C probably benign Het
Klc1 A G 12: 111,785,445 K441R probably benign Het
Kmt2a A G 9: 44,847,744 L936P probably damaging Het
Map3k6 T C 4: 133,251,927 V1197A probably benign Het
Mthfsd C T 8: 121,098,786 A349T probably benign Het
Mtmr7 G A 8: 40,597,384 R123W probably damaging Het
Muc16 T A 9: 18,642,131 I4289F probably benign Het
Muc16 G A 9: 18,655,451 T1924I unknown Het
Mybpc3 A C 2: 91,120,487 D220A probably damaging Het
Neb A T 2: 52,256,575 probably null Het
Nectin2 A G 7: 19,730,619 W287R probably damaging Het
Nipsnap1 A T 11: 4,884,089 T114S probably damaging Het
Nol9 T C 4: 152,039,658 S102P probably benign Het
Olfml2b A T 1: 170,649,833 K179I possibly damaging Het
Olfr1253 G T 2: 89,752,321 P169H probably damaging Het
Phf7 T C 14: 31,238,429 D284G probably benign Het
Pias3 A G 3: 96,702,218 T319A possibly damaging Het
Pik3ip1 A T 11: 3,333,558 I189F probably damaging Het
Pik3r1 T A 13: 101,689,406 T371S probably damaging Het
Prmt7 A G 8: 106,237,386 D304G probably benign Het
Prpf6 T C 2: 181,652,455 V818A probably benign Het
Pstpip2 A G 18: 77,871,605 E185G probably damaging Het
Ptprz1 T G 6: 22,999,896 F662V possibly damaging Het
Rasgrp3 T C 17: 75,496,416 F70L probably benign Het
Rcor1 A T 12: 111,067,837 probably null Het
Rnasel A G 1: 153,754,560 K274R probably benign Het
Rsbn1l G A 5: 20,896,457 T695I probably benign Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Het
Sema3a T C 5: 13,561,820 V351A probably benign Het
Serpina12 A G 12: 104,038,328 L15P unknown Het
Siah1a G A 8: 86,725,212 R215C probably benign Het
Sin3a T A 9: 57,103,926 V489D possibly damaging Het
Slc22a17 A G 14: 54,912,118 I208T probably benign Het
Slc36a4 G A 9: 15,734,215 V313M possibly damaging Het
Sod1 T A 16: 90,226,226 L145* probably null Het
Svep1 T C 4: 58,053,260 N3362D possibly damaging Het
Taf4b T C 18: 14,813,545 L475P probably damaging Het
Telo2 G T 17: 25,110,821 T239K probably benign Het
Trmt11 T G 10: 30,560,874 D290A probably damaging Het
Trpc4 A T 3: 54,318,095 D955V possibly damaging Het
Trpv6 T C 6: 41,626,167 N257S probably benign Het
Usp12 T C 5: 146,794,620 T15A probably benign Het
Vars2 G T 17: 35,660,780 Q526K probably damaging Het
Vipas39 A G 12: 87,263,903 probably null Het
Zfp689 A T 7: 127,444,838 C207S probably damaging Het
Zfpl1 C A 19: 6,084,402 E18* probably null Het
Other mutations in Pcnt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01075:Pcnt APN 10 76422904 nonsense probably null
IGL01307:Pcnt APN 10 76411588 missense probably damaging 1.00
IGL01549:Pcnt APN 10 76367486 splice site probably null
IGL01576:Pcnt APN 10 76368822 missense probably damaging 0.99
IGL01611:Pcnt APN 10 76436424 critical splice donor site probably null
IGL01630:Pcnt APN 10 76420246 missense probably damaging 0.99
IGL01647:Pcnt APN 10 76370001 nonsense probably null
IGL01689:Pcnt APN 10 76411653 missense probably damaging 1.00
IGL01690:Pcnt APN 10 76392775 missense probably damaging 1.00
IGL01723:Pcnt APN 10 76418499 missense possibly damaging 0.63
IGL01920:Pcnt APN 10 76404528 missense probably damaging 1.00
IGL01958:Pcnt APN 10 76433679 missense probably damaging 0.96
IGL02210:Pcnt APN 10 76389219 missense possibly damaging 0.95
IGL02225:Pcnt APN 10 76389474 missense probably benign 0.00
IGL02228:Pcnt APN 10 76389474 missense probably benign 0.00
IGL02237:Pcnt APN 10 76352984 missense probably damaging 1.00
IGL02279:Pcnt APN 10 76403765 missense probably damaging 1.00
IGL02303:Pcnt APN 10 76442559 splice site probably benign
IGL02355:Pcnt APN 10 76375162 nonsense probably null
IGL02362:Pcnt APN 10 76375162 nonsense probably null
IGL02428:Pcnt APN 10 76429256 missense probably damaging 0.99
IGL02536:Pcnt APN 10 76380229 missense possibly damaging 0.68
IGL02715:Pcnt APN 10 76368722 splice site probably benign
IGL02800:Pcnt APN 10 76412583 nonsense probably null
IGL03395:Pcnt APN 10 76436491 missense possibly damaging 0.95
IGL02799:Pcnt UTSW 10 76412583 nonsense probably null
PIT4520001:Pcnt UTSW 10 76420235 missense probably damaging 0.99
R0049:Pcnt UTSW 10 76369821 unclassified probably benign
R0049:Pcnt UTSW 10 76369821 unclassified probably benign
R0109:Pcnt UTSW 10 76389196 missense probably benign 0.00
R0117:Pcnt UTSW 10 76408727 nonsense probably null
R0254:Pcnt UTSW 10 76392580 missense probably benign 0.10
R0392:Pcnt UTSW 10 76384826 missense probably benign
R0511:Pcnt UTSW 10 76404595 missense possibly damaging 0.66
R0570:Pcnt UTSW 10 76412107 missense probably damaging 1.00
R0614:Pcnt UTSW 10 76420316 missense probably damaging 1.00
R0635:Pcnt UTSW 10 76404585 missense probably damaging 1.00
R0707:Pcnt UTSW 10 76420541 missense probably damaging 1.00
R0749:Pcnt UTSW 10 76381364 missense probably damaging 1.00
R0969:Pcnt UTSW 10 76427951 missense probably damaging 1.00
R1172:Pcnt UTSW 10 76393044 splice site probably null
R1174:Pcnt UTSW 10 76393044 splice site probably null
R1175:Pcnt UTSW 10 76393044 splice site probably null
R1512:Pcnt UTSW 10 76404662 splice site probably null
R1542:Pcnt UTSW 10 76389387 missense probably benign 0.08
R1542:Pcnt UTSW 10 76401386 missense probably benign 0.02
R1558:Pcnt UTSW 10 76422922 missense possibly damaging 0.53
R1562:Pcnt UTSW 10 76367330 missense probably benign 0.02
R1762:Pcnt UTSW 10 76355137 critical splice acceptor site probably null
R1779:Pcnt UTSW 10 76408796 missense probably damaging 0.99
R1869:Pcnt UTSW 10 76379906 missense probably null 0.94
R1911:Pcnt UTSW 10 76368816 missense possibly damaging 0.94
R1985:Pcnt UTSW 10 76380337 missense possibly damaging 0.95
R1995:Pcnt UTSW 10 76392799 nonsense probably null
R2073:Pcnt UTSW 10 76380380 missense possibly damaging 0.92
R2111:Pcnt UTSW 10 76420526 missense probably damaging 0.99
R2112:Pcnt UTSW 10 76420526 missense probably damaging 0.99
R2309:Pcnt UTSW 10 76442626 start gained probably benign
R2902:Pcnt UTSW 10 76375230 missense probably damaging 0.98
R3623:Pcnt UTSW 10 76433750 missense probably benign 0.23
R4088:Pcnt UTSW 10 76428014 missense probably damaging 1.00
R4300:Pcnt UTSW 10 76367391 missense probably benign 0.40
R4402:Pcnt UTSW 10 76392393 missense probably benign 0.00
R4407:Pcnt UTSW 10 76374870 missense possibly damaging 0.90
R4483:Pcnt UTSW 10 76401483 missense probably damaging 1.00
R4647:Pcnt UTSW 10 76354213 missense probably benign 0.01
R4734:Pcnt UTSW 10 76437206 missense probably benign 0.25
R4747:Pcnt UTSW 10 76436465 missense possibly damaging 0.91
R4782:Pcnt UTSW 10 76409577 missense possibly damaging 0.62
R4795:Pcnt UTSW 10 76370024 missense probably benign 0.21
R4831:Pcnt UTSW 10 76412501 missense probably damaging 0.96
R4873:Pcnt UTSW 10 76369854 missense probably benign 0.03
R4875:Pcnt UTSW 10 76369854 missense probably benign 0.03
R4946:Pcnt UTSW 10 76356185 missense probably damaging 1.00
R5032:Pcnt UTSW 10 76355077 missense probably benign 0.00
R5033:Pcnt UTSW 10 76399945 missense possibly damaging 0.95
R5106:Pcnt UTSW 10 76401444 missense probably damaging 1.00
R5118:Pcnt UTSW 10 76412168 missense probably damaging 0.98
R5167:Pcnt UTSW 10 76420424 missense probably damaging 0.97
R5199:Pcnt UTSW 10 76418544 missense probably benign 0.09
R5223:Pcnt UTSW 10 76380272 missense probably damaging 0.99
R5241:Pcnt UTSW 10 76433617 missense probably benign 0.26
R5308:Pcnt UTSW 10 76356325 nonsense probably null
R5328:Pcnt UTSW 10 76411719 missense probably damaging 1.00
R5454:Pcnt UTSW 10 76389547 splice site probably null
R5543:Pcnt UTSW 10 76412052 missense probably benign 0.01
R5588:Pcnt UTSW 10 76442611 missense possibly damaging 0.74
R5647:Pcnt UTSW 10 76385841 missense probably benign 0.17
R5668:Pcnt UTSW 10 76409500 missense probably benign 0.16
R5712:Pcnt UTSW 10 76429271 missense probably damaging 0.96
R5714:Pcnt UTSW 10 76420491 missense probably damaging 1.00
R5797:Pcnt UTSW 10 76392756 missense probably benign 0.00
R5946:Pcnt UTSW 10 76382063 missense possibly damaging 0.91
R5955:Pcnt UTSW 10 76411622 missense possibly damaging 0.45
R6024:Pcnt UTSW 10 76420037 missense possibly damaging 0.87
R6267:Pcnt UTSW 10 76385798 missense probably benign 0.02
R6485:Pcnt UTSW 10 76389330 nonsense probably null
R6605:Pcnt UTSW 10 76429198 critical splice donor site probably null
R6877:Pcnt UTSW 10 76434017 missense possibly damaging 0.94
R6882:Pcnt UTSW 10 76427828 missense probably benign 0.00
R6919:Pcnt UTSW 10 76385798 missense probably benign 0.02
R7025:Pcnt UTSW 10 76403835 missense probably damaging 1.00
R7098:Pcnt UTSW 10 76384839 missense probably benign
R7109:Pcnt UTSW 10 76369904 missense probably damaging 1.00
R7121:Pcnt UTSW 10 76427927 missense possibly damaging 0.73
R7143:Pcnt UTSW 10 76389060 missense possibly damaging 0.47
R7152:Pcnt UTSW 10 76411360 splice site probably null
R7213:Pcnt UTSW 10 76408904 missense probably damaging 1.00
R7368:Pcnt UTSW 10 76400001 missense probably benign
R7453:Pcnt UTSW 10 76389450 missense probably benign
R7486:Pcnt UTSW 10 76418436 missense probably benign 0.03
R7486:Pcnt UTSW 10 76418437 missense probably benign
R7575:Pcnt UTSW 10 76389252 missense probably benign 0.32
R7662:Pcnt UTSW 10 76387522 missense probably benign 0.27
R7685:Pcnt UTSW 10 76422808 missense probably benign 0.14
R7764:Pcnt UTSW 10 76354248 missense probably benign 0.33
R7802:Pcnt UTSW 10 76375303 splice site probably null
R8432:Pcnt UTSW 10 76420205 missense probably damaging 1.00
R8439:Pcnt UTSW 10 76420205 missense probably damaging 1.00
Z1176:Pcnt UTSW 10 76382157 nonsense probably null
Z1177:Pcnt UTSW 10 76399968 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGTGAGCCTTTATGCAGAAGGG -3'
(R):5'- GCATGCTCAGGTAAGCTCAG -3'

Sequencing Primer
(F):5'- CCTTTATGCAGAAGGGCTCGG -3'
(R):5'- CTCAGGTAAGCTCAGATATGTGC -3'
Posted On2019-10-17