Incidental Mutation 'R7538:Dock8'
ID583762
Institutional Source Beutler Lab
Gene Symbol Dock8
Ensembl Gene ENSMUSG00000052085
Gene Namededicator of cytokinesis 8
SynonymsA130095G14Rik, 5830472H07Rik, 1200017A24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R7538 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location24999529-25202432 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 25158418 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 1200 (D1200V)
Ref Sequence ENSEMBL: ENSMUSP00000025831 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025831]
PDB Structure Crystal structure of the DHR-2 domain of DOCK8 in complex with Cdc42 (T17N mutant) [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000025831
AA Change: D1200V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025831
Gene: ENSMUSG00000052085
AA Change: D1200V

DomainStartEndE-ValueType
Pfam:DUF3398 71 164 3.9e-25 PFAM
Pfam:DOCK-C2 557 739 6.7e-49 PFAM
low complexity region 786 803 N/A INTRINSIC
low complexity region 1003 1020 N/A INTRINSIC
low complexity region 1123 1138 N/A INTRINSIC
low complexity region 1236 1246 N/A INTRINSIC
low complexity region 1371 1383 N/A INTRINSIC
Pfam:DHR-2 1534 2060 5e-210 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (77/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DOCK180 family of guanine nucleotide exchange factors. Guanine nucleotide exchange factors interact with Rho GTPases and are components of intracellular signaling networks. Mutations in this gene result in the autosomal recessive form of the hyper-IgE syndrome. Alternatively spliced transcript variants encoding different isoforms have been described.[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for inactivating mutations of this gene exhibit loss of marginal zone B cells, decrease in peritoneal B1 cells and peripheral naive T cells, failure of sustained antibody response after immunization, failure of germinal center persistence, and failure of B cell affinity maturation. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Gene trapped(4) Chemically induced(2)

Mice homozygous for inactivating mutations of this gene exhibit loss of marginal zone B cells, decrease in peritoneal B1 cells and peripheral naive T cells, failure of sustained antibody response after immunization, failure of germinal center persistence, and failure of B cell affinity maturation.

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts8 C A 9: 30,953,470 P419H probably damaging Het
Adgra3 C T 5: 49,961,450 V919I probably benign Het
Akap12 G A 10: 4,353,213 V113I probably damaging Het
Akr1d1 T A 6: 37,536,108 I113K probably benign Het
Alx3 A T 3: 107,604,364 I230F probably damaging Het
Apob A T 12: 8,002,219 D1220V probably damaging Het
Ascc3 T C 10: 50,845,700 L2083P probably damaging Het
Atp10b A G 11: 43,225,546 I907V probably benign Het
B4galnt3 G T 6: 120,294,423 S46* probably null Het
Bfsp1 A C 2: 143,831,835 probably null Het
Cant1 G A 11: 118,411,465 R9W possibly damaging Het
Ccdc88a A T 11: 29,463,370 H636L probably benign Het
Cfi G A 3: 129,858,815 R297H probably benign Het
Cherp T A 8: 72,462,419 Q749L Het
Clec10a A G 11: 70,169,778 D153G probably benign Het
Cnga1 T C 5: 72,612,380 K99E probably benign Het
Cyp2r1 A T 7: 114,562,767 V64D probably damaging Het
Dact3 T A 7: 16,875,518 W32R probably damaging Het
Dennd4c T C 4: 86,774,516 C88R probably damaging Het
Drosha C G 15: 12,926,243 S1262W probably damaging Het
Dtnb T C 12: 3,773,611 M592T possibly damaging Het
Eef2k T A 7: 120,891,992 V567E probably benign Het
Fem1b A G 9: 62,811,167 S47P probably damaging Het
Fryl T C 5: 73,022,676 E2864G probably benign Het
Fscn2 A G 11: 120,367,326 N358S possibly damaging Het
Fsip2 T C 2: 82,988,550 S4876P possibly damaging Het
Ggh C G 4: 20,049,833 S88C probably damaging Het
Grhl2 T C 15: 37,328,359 Y410H probably damaging Het
Gucy2c C T 6: 136,709,744 G831D probably damaging Het
Hars A T 18: 36,771,141 D228E probably benign Het
Hdhd5 T C 6: 120,521,296 D114G possibly damaging Het
Kcna2 A G 3: 107,104,568 Y155C probably benign Het
Klc1 A G 12: 111,785,445 K441R probably benign Het
Kmt2a A G 9: 44,847,744 L936P probably damaging Het
Map3k6 T C 4: 133,251,927 V1197A probably benign Het
Mthfsd C T 8: 121,098,786 A349T probably benign Het
Mtmr7 G A 8: 40,597,384 R123W probably damaging Het
Muc16 G A 9: 18,655,451 T1924I unknown Het
Muc16 T A 9: 18,642,131 I4289F probably benign Het
Mybpc3 A C 2: 91,120,487 D220A probably damaging Het
Neb A T 2: 52,256,575 probably null Het
Nectin2 A G 7: 19,730,619 W287R probably damaging Het
Nipsnap1 A T 11: 4,884,089 T114S probably damaging Het
Nol9 T C 4: 152,039,658 S102P probably benign Het
Olfml2b A T 1: 170,649,833 K179I possibly damaging Het
Olfr1253 G T 2: 89,752,321 P169H probably damaging Het
Pcnt T C 10: 76,399,939 M1403V probably benign Het
Phf7 T C 14: 31,238,429 D284G probably benign Het
Pias3 A G 3: 96,702,218 T319A possibly damaging Het
Pik3ip1 A T 11: 3,333,558 I189F probably damaging Het
Pik3r1 T A 13: 101,689,406 T371S probably damaging Het
Prmt7 A G 8: 106,237,386 D304G probably benign Het
Prpf6 T C 2: 181,652,455 V818A probably benign Het
Pstpip2 A G 18: 77,871,605 E185G probably damaging Het
Ptprz1 T G 6: 22,999,896 F662V possibly damaging Het
Rasgrp3 T C 17: 75,496,416 F70L probably benign Het
Rcor1 A T 12: 111,067,837 probably null Het
Rnasel A G 1: 153,754,560 K274R probably benign Het
Rsbn1l G A 5: 20,896,457 T695I probably benign Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Het
Sema3a T C 5: 13,561,820 V351A probably benign Het
Serpina12 A G 12: 104,038,328 L15P unknown Het
Siah1a G A 8: 86,725,212 R215C probably benign Het
Sin3a T A 9: 57,103,926 V489D possibly damaging Het
Slc22a17 A G 14: 54,912,118 I208T probably benign Het
Slc36a4 G A 9: 15,734,215 V313M possibly damaging Het
Sod1 T A 16: 90,226,226 L145* probably null Het
Svep1 T C 4: 58,053,260 N3362D possibly damaging Het
Taf4b T C 18: 14,813,545 L475P probably damaging Het
Telo2 G T 17: 25,110,821 T239K probably benign Het
Trmt11 T G 10: 30,560,874 D290A probably damaging Het
Trpc4 A T 3: 54,318,095 D955V possibly damaging Het
Trpv6 T C 6: 41,626,167 N257S probably benign Het
Usp12 T C 5: 146,794,620 T15A probably benign Het
Vars2 G T 17: 35,660,780 Q526K probably damaging Het
Vipas39 A G 12: 87,263,903 probably null Het
Zfp689 A T 7: 127,444,838 C207S probably damaging Het
Zfpl1 C A 19: 6,084,402 E18* probably null Het
Other mutations in Dock8
AlleleSourceChrCoordTypePredicted EffectPPH Score
captain_morgan APN 19 25127711 critical splice donor site probably benign
primurus APN 19 25183609 missense probably damaging 1.00
IGL00737:Dock8 APN 19 25182976 missense probably benign 0.00
IGL00755:Dock8 APN 19 25051509 missense probably benign 0.09
IGL00822:Dock8 APN 19 25188409 nonsense probably null
IGL00838:Dock8 APN 19 25175459 nonsense probably null
IGL01419:Dock8 APN 19 25119452 missense probably benign 0.08
IGL01456:Dock8 APN 19 25119499 missense possibly damaging 0.95
IGL01532:Dock8 APN 19 25169441 missense probably damaging 0.99
IGL01602:Dock8 APN 19 25089888 splice site probably benign
IGL01605:Dock8 APN 19 25089888 splice site probably benign
IGL01753:Dock8 APN 19 25061292 splice site probably benign
IGL01843:Dock8 APN 19 25089928 missense probably benign 0.02
IGL02032:Dock8 APN 19 25130405 missense probably damaging 0.99
IGL02073:Dock8 APN 19 25200986 critical splice acceptor site probably null
IGL02192:Dock8 APN 19 25078205 critical splice donor site probably null
IGL02402:Dock8 APN 19 25078145 missense probably benign 0.25
IGL02529:Dock8 APN 19 25100926 nonsense probably null
IGL02728:Dock8 APN 19 25132220 missense probably benign
IGL02739:Dock8 APN 19 25188488 missense probably damaging 1.00
IGL03037:Dock8 APN 19 25086181 missense probably benign 0.02
IGL03104:Dock8 APN 19 25201020 nonsense probably null
IGL03137:Dock8 APN 19 25155948 missense probably benign 0.19
IGL03365:Dock8 APN 19 25099684 missense possibly damaging 0.70
Defenseless UTSW 19 25051563 missense probably benign 0.00
Guardate UTSW 19 25149831 missense probably benign
hillock UTSW 19 25174333 critical splice donor site probably null
Molehill UTSW 19 25130461 missense probably damaging 1.00
Pap UTSW 19 25122441 missense probably benign 0.31
snowdrop UTSW 19 25184941 critical splice donor site probably null
warts_and_all UTSW 19 25169501 critical splice donor site probably null
R0021:Dock8 UTSW 19 25163047 missense probably benign 0.01
R0147:Dock8 UTSW 19 25119459 missense probably benign 0.00
R0148:Dock8 UTSW 19 25119459 missense probably benign 0.00
R0294:Dock8 UTSW 19 25188350 missense probably damaging 1.00
R0537:Dock8 UTSW 19 25171577 missense probably benign 0.08
R0630:Dock8 UTSW 19 25061160 missense probably benign 0.10
R1163:Dock8 UTSW 19 25051503 missense probably benign
R1164:Dock8 UTSW 19 25090027 missense probably benign 0.44
R1471:Dock8 UTSW 19 25201036 missense possibly damaging 0.74
R1477:Dock8 UTSW 19 25095550 missense possibly damaging 0.95
R1633:Dock8 UTSW 19 25051563 missense probably benign 0.00
R1803:Dock8 UTSW 19 25132235 missense probably benign 0.00
R1822:Dock8 UTSW 19 25161058 missense probably benign 0.31
R1852:Dock8 UTSW 19 25127128 missense probably benign 0.45
R1916:Dock8 UTSW 19 25061157 missense probably benign 0.02
R1984:Dock8 UTSW 19 25121181 missense probably null 0.95
R2311:Dock8 UTSW 19 25183004 missense possibly damaging 0.93
R2341:Dock8 UTSW 19 25200393 missense probably damaging 0.99
R2483:Dock8 UTSW 19 25079877 missense probably benign
R3116:Dock8 UTSW 19 25188494 missense probably benign 0.00
R3157:Dock8 UTSW 19 25149831 missense probably benign
R3623:Dock8 UTSW 19 25079877 missense probably benign
R3624:Dock8 UTSW 19 25079877 missense probably benign
R3800:Dock8 UTSW 19 25164352 missense probably benign 0.08
R3844:Dock8 UTSW 19 25065430 nonsense probably null
R3895:Dock8 UTSW 19 25051501 missense probably benign 0.31
R3901:Dock8 UTSW 19 25100905 missense possibly damaging 0.69
R3959:Dock8 UTSW 19 25184941 critical splice donor site probably null
R4428:Dock8 UTSW 19 25200499 missense probably damaging 0.98
R4428:Dock8 UTSW 19 25065390 missense probably benign 0.00
R4429:Dock8 UTSW 19 25065390 missense probably benign 0.00
R4431:Dock8 UTSW 19 25065390 missense probably benign 0.00
R4545:Dock8 UTSW 19 25188358 missense probably damaging 1.00
R4839:Dock8 UTSW 19 25169494 missense probably benign 0.00
R4897:Dock8 UTSW 19 25181637 missense probably benign 0.00
R4939:Dock8 UTSW 19 25122400 missense probably damaging 1.00
R4995:Dock8 UTSW 19 25158383 missense probably benign 0.02
R5035:Dock8 UTSW 19 25086207 missense probably damaging 0.99
R5294:Dock8 UTSW 19 25061153 missense probably benign 0.01
R5324:Dock8 UTSW 19 25163094 missense probably benign 0.17
R5478:Dock8 UTSW 19 25079822 missense probably benign
R5704:Dock8 UTSW 19 25174222 missense probably damaging 1.00
R5724:Dock8 UTSW 19 25122421 missense probably damaging 1.00
R5745:Dock8 UTSW 19 25130397 missense probably benign 0.02
R5864:Dock8 UTSW 19 25061220 missense probably damaging 0.99
R5870:Dock8 UTSW 19 25132126 missense probably benign
R5893:Dock8 UTSW 19 25122447 missense probably damaging 1.00
R5954:Dock8 UTSW 19 25171619 missense probably damaging 1.00
R6087:Dock8 UTSW 19 25161074 missense probably benign 0.00
R6223:Dock8 UTSW 19 25161052 missense probably benign 0.00
R6391:Dock8 UTSW 19 25095550 missense possibly damaging 0.95
R6759:Dock8 UTSW 19 25127484 missense probably damaging 0.99
R6786:Dock8 UTSW 19 25183022 missense possibly damaging 0.49
R6794:Dock8 UTSW 19 25122441 missense probably benign 0.31
R6818:Dock8 UTSW 19 25169501 critical splice donor site probably null
R6885:Dock8 UTSW 19 25147378 missense possibly damaging 0.95
R6908:Dock8 UTSW 19 25188382 missense probably damaging 1.00
R6923:Dock8 UTSW 19 25095606 missense probably benign
R7001:Dock8 UTSW 19 25099677 missense probably benign
R7141:Dock8 UTSW 19 25181620 missense probably null 0.75
R7203:Dock8 UTSW 19 25181563 missense probably damaging 1.00
R7257:Dock8 UTSW 19 25127085 missense probably benign 0.08
R7296:Dock8 UTSW 19 25184881 missense probably benign 0.00
R7555:Dock8 UTSW 19 25175400 missense probably damaging 0.99
R7641:Dock8 UTSW 19 25174333 critical splice donor site probably null
R7764:Dock8 UTSW 19 25097535 missense probably benign
R7859:Dock8 UTSW 19 25183570 missense probably damaging 1.00
R7864:Dock8 UTSW 19 25163500 missense possibly damaging 0.95
R8090:Dock8 UTSW 19 25154242 missense probably damaging 1.00
R8160:Dock8 UTSW 19 25147347 missense probably damaging 1.00
R8287:Dock8 UTSW 19 25130461 missense probably damaging 1.00
R8295:Dock8 UTSW 19 25123236 missense probably benign 0.04
R8443:Dock8 UTSW 19 25155917 missense probably benign 0.04
R8537:Dock8 UTSW 19 25130506 missense probably benign 0.00
R8673:Dock8 UTSW 19 25183503 missense probably damaging 0.96
R8709:Dock8 UTSW 19 25078084 nonsense probably null
X0027:Dock8 UTSW 19 25161129 missense probably benign
Z1177:Dock8 UTSW 19 25132123 missense probably benign 0.05
Z1177:Dock8 UTSW 19 25155972 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- CACATGGTCACTGAATTGTCC -3'
(R):5'- ACTAGCCGATCAATGAATGAAGAAC -3'

Sequencing Primer
(F):5'- GGTCACTGAATTGTCCAGGATAC -3'
(R):5'- AAAGGTTTAGTGACCACTGCTG -3'
Posted On2019-10-17