Incidental Mutation 'R7539:Crb1'
ID583763
Institutional Source Beutler Lab
Gene Symbol Crb1
Ensembl Gene ENSMUSG00000063681
Gene Namecrumbs family member 1, photoreceptor morphogenesis associated
Synonyms7530426H14Rik, A930008G09Rik
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_133239.2; MGI: 2136343

Is this an essential gene? Possibly non essential (E-score: 0.299) question?
Stock #R7539 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location139197056-139377100 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 139248229 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Threonine at position 672 (K672T)
Ref Sequence ENSEMBL: ENSMUSP00000060769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059825] [ENSMUST00000196402] [ENSMUST00000198445] [ENSMUST00000200340]
Predicted Effect probably damaging
Transcript: ENSMUST00000059825
AA Change: K672T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000060769
Gene: ENSMUSG00000063681
AA Change: K672T

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
EGF 72 107 5.97e-4 SMART
EGF 112 145 9.19e-5 SMART
EGF_CA 147 183 2.89e-11 SMART
EGF_CA 185 221 1.14e-9 SMART
EGF_CA 223 259 2.26e-13 SMART
EGF_CA 261 298 5.15e-8 SMART
EGF 303 336 8.12e-6 SMART
EGF 341 394 2.6e-4 SMART
EGF_CA 396 438 2.54e-7 SMART
EGF 443 480 1.47e-3 SMART
LamG 505 650 1.75e-9 SMART
EGF 674 707 6.5e-5 SMART
LamG 734 859 1.05e-7 SMART
EGF 889 922 1.19e-3 SMART
LamG 971 1104 6.85e-12 SMART
EGF 1141 1174 7.07e-6 SMART
EGF_CA 1176 1211 3.01e-9 SMART
EGF 1216 1249 3.57e-2 SMART
EGF 1257 1294 6.92e0 SMART
EGF_CA 1296 1332 4.19e-8 SMART
transmembrane domain 1346 1368 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000196402
AA Change: K672T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142702
Gene: ENSMUSG00000063681
AA Change: K672T

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
EGF 72 107 5.97e-4 SMART
EGF 112 145 9.19e-5 SMART
EGF_CA 147 183 2.89e-11 SMART
EGF_CA 185 221 1.14e-9 SMART
EGF_CA 223 259 2.26e-13 SMART
EGF_CA 261 298 5.15e-8 SMART
EGF 303 336 8.12e-6 SMART
EGF 341 394 2.6e-4 SMART
EGF_CA 396 438 2.54e-7 SMART
EGF 443 480 1.47e-3 SMART
LamG 505 650 1.75e-9 SMART
EGF 674 707 6.5e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197035
Predicted Effect probably damaging
Transcript: ENSMUST00000198445
AA Change: K611T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142552
Gene: ENSMUSG00000063681
AA Change: K611T

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
EGF 72 107 5.97e-4 SMART
EGF 112 145 9.19e-5 SMART
EGF_CA 147 183 2.89e-11 SMART
EGF_CA 185 221 1.14e-9 SMART
EGF_CA 223 259 2.26e-13 SMART
EGF_CA 261 298 5.15e-8 SMART
EGF 303 333 1.63e1 SMART
EGF_CA 335 377 2.54e-7 SMART
EGF 382 419 1.47e-3 SMART
LamG 444 589 1.75e-9 SMART
EGF 613 646 6.5e-5 SMART
LamG 673 798 1.05e-7 SMART
EGF 828 861 1.19e-3 SMART
LamG 910 1043 6.85e-12 SMART
EGF 1080 1113 7.07e-6 SMART
EGF_CA 1115 1150 3.01e-9 SMART
EGF 1155 1188 3.57e-2 SMART
EGF 1196 1233 6.92e0 SMART
EGF_CA 1235 1271 4.19e-8 SMART
low complexity region 1282 1296 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200340
SMART Domains Protein: ENSMUSP00000142909
Gene: ENSMUSG00000063681

DomainStartEndE-ValueType
EGF_CA 12 49 5.15e-8 SMART
EGF 54 88 1.47e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (63/63)
MGI Phenotype Strain: 3052072; 2676366
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is similar to the Drosophila crumbs protein and localizes to the inner segment of mammalian photoreceptors. In Drosophila crumbs localizes to the stalk of the fly photoreceptor and may be a component of the molecular scaffold that controls proper development of polarity in the eye. Mutations in this gene are associated with a severe form of retinitis pigmentosa, RP12, and with Leber congenital amaurosis. Alternate splicing results in multiple transcript variants, some protein coding and some non-protein coding.[provided by RefSeq, Apr 2012]
PHENOTYPE: Homozygotes for a null allele show focal retinal lesions, loss of adherens junctions between photoreceptors and Muller glia cells, and light-accelerated retinal degeneration. Homozygotes for a spontaneous allele show background-sensitive retinal spotting, photoreceptor dysplasia and degeneration. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted(4) Spontaneous(1)
 

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,201,244 I1002V probably benign Het
4930516K23Rik T C 7: 104,059,263 E113G probably damaging Het
Abcf3 T C 16: 20,552,632 probably null Het
Agbl1 T C 7: 76,425,929 probably null Het
Ap5m1 C A 14: 49,073,557 P28Q probably damaging Het
Bet1l T C 7: 140,854,544 D83G probably benign Het
Birc6 T C 17: 74,649,696 S3571P probably damaging Het
Bod1l A T 5: 41,817,860 M2037K possibly damaging Het
Ccdc80 A T 16: 45,095,082 E67V probably benign Het
Cep112 A G 11: 108,855,828 M133V probably benign Het
Ckmt2 C A 13: 91,859,944 D224Y probably damaging Het
Dnhd1 T C 7: 105,720,912 S4515P probably damaging Het
Dock9 A G 14: 121,581,436 S1545P probably damaging Het
Dopey1 T G 9: 86,521,573 S145A probably benign Het
Eps8l1 T C 7: 4,470,037 S92P probably damaging Het
Faap100 T C 11: 120,377,638 D103G possibly damaging Het
Fech T A 18: 64,483,494 probably null Het
Folh1 T A 7: 86,725,909 E623V probably benign Het
Galnt5 T C 2: 58,035,230 L841P probably damaging Het
Ggh C G 4: 20,049,833 S88C probably damaging Het
Gm10577 C T 4: 101,020,696 V1I unknown Het
Grip1 T A 10: 120,054,871 H938Q probably benign Het
Gucy2g G A 19: 55,203,154 A955V probably damaging Het
Hpd G C 5: 123,178,192 Y165* probably null Het
Iqsec1 C A 6: 90,662,891 R955L probably benign Het
Masp1 A T 16: 23,470,378 H557Q possibly damaging Het
Muc4 C T 16: 32,756,396 T20M Het
Myo16 T C 8: 10,361,095 probably null Het
Nfkb2 T C 19: 46,308,223 F273L possibly damaging Het
Olfr1299 T C 2: 111,664,433 V69A possibly damaging Het
Olfr1489 C T 19: 13,633,569 Q153* probably null Het
Olfr323 A T 11: 58,625,956 I29N probably damaging Het
Olfr355 T C 2: 36,927,209 R302G probably benign Het
Olfr444 T C 6: 42,956,103 C202R possibly damaging Het
Olfr594 T C 7: 103,220,066 V116A possibly damaging Het
Olfr598 A G 7: 103,328,494 S3G probably benign Het
Olfr791 A T 10: 129,527,105 K293* probably null Het
Olfr816 T C 10: 129,912,063 T72A probably damaging Het
Olfr868 A T 9: 20,101,619 M287L probably benign Het
Parp4 T A 14: 56,635,755 I1152N probably damaging Het
Peg3 T C 7: 6,708,168 T1352A probably benign Het
Pik3c2a T C 7: 116,340,096 N1669S probably damaging Het
Pinx1 A T 14: 63,919,206 Q194L probably benign Het
Podxl2 A C 6: 88,849,329 S268A probably benign Het
Polr2c C A 8: 94,870,779 H363N unknown Het
Prlr C T 15: 10,329,023 T528I probably benign Het
Rab37 A C 11: 115,160,661 Q198P probably benign Het
Rrm2b T A 15: 37,937,351 probably null Het
Serpina3b T C 12: 104,130,711 S84P possibly damaging Het
Slc9a3r2 G T 17: 24,641,899 A223D probably damaging Het
Stat4 A T 1: 52,071,709 probably null Het
Them6 T C 15: 74,723,500 I185T probably damaging Het
Tmco4 T A 4: 139,021,699 M316K probably benign Het
Tmtc4 G T 14: 122,978,289 probably null Het
Tnni3k A T 3: 154,962,031 N248K probably benign Het
Trim43a T A 9: 88,583,043 L141Q probably benign Het
Utp20 C T 10: 88,791,745 V953M probably damaging Het
Vmn2r118 T A 17: 55,592,853 T684S probably damaging Het
Wasl A T 6: 24,619,198 I441N unknown Het
Wfikkn2 T C 11: 94,242,359 D64G probably damaging Het
Zfp128 C A 7: 12,890,552 Y282* probably null Het
Other mutations in Crb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00593:Crb1 APN 1 139323245 missense probably benign 0.16
IGL01591:Crb1 APN 1 139237339 missense probably damaging 1.00
IGL01644:Crb1 APN 1 139237630 nonsense probably null
IGL01769:Crb1 APN 1 139337068 missense probably damaging 1.00
IGL02172:Crb1 APN 1 139237227 missense probably damaging 1.00
IGL02294:Crb1 APN 1 139234782 missense possibly damaging 0.89
IGL02382:Crb1 APN 1 139237614 missense probably damaging 0.99
IGL02411:Crb1 APN 1 139248475 missense probably damaging 1.00
IGL03070:Crb1 APN 1 139241258 missense possibly damaging 0.79
IGL02984:Crb1 UTSW 1 139237086 frame shift probably null
IGL02988:Crb1 UTSW 1 139237086 frame shift probably null
IGL02991:Crb1 UTSW 1 139237084 frame shift probably null
IGL02991:Crb1 UTSW 1 139237086 frame shift probably null
IGL03014:Crb1 UTSW 1 139237086 frame shift probably null
IGL03050:Crb1 UTSW 1 139237086 frame shift probably null
IGL03054:Crb1 UTSW 1 139237086 frame shift probably null
IGL03055:Crb1 UTSW 1 139237086 frame shift probably null
IGL03097:Crb1 UTSW 1 139237086 frame shift probably null
IGL03098:Crb1 UTSW 1 139237086 frame shift probably null
IGL03134:Crb1 UTSW 1 139237086 frame shift probably null
IGL03138:Crb1 UTSW 1 139237086 frame shift probably null
IGL03147:Crb1 UTSW 1 139237086 frame shift probably null
P0017:Crb1 UTSW 1 139248940 missense possibly damaging 0.64
R0276:Crb1 UTSW 1 139323335 missense possibly damaging 0.85
R0325:Crb1 UTSW 1 139241166 missense probably damaging 1.00
R0401:Crb1 UTSW 1 139198791 splice site probably benign
R0479:Crb1 UTSW 1 139198614 missense probably damaging 0.98
R0734:Crb1 UTSW 1 139337084 missense probably benign 0.25
R1573:Crb1 UTSW 1 139337606 missense probably damaging 1.00
R1728:Crb1 UTSW 1 139234779 missense probably benign
R1728:Crb1 UTSW 1 139237622 missense probably benign 0.00
R1728:Crb1 UTSW 1 139241138 missense probably damaging 1.00
R1728:Crb1 UTSW 1 139242995 missense probably damaging 1.00
R1728:Crb1 UTSW 1 139243417 missense probably benign 0.00
R1729:Crb1 UTSW 1 139234779 missense probably benign
R1729:Crb1 UTSW 1 139237622 missense probably benign 0.00
R1729:Crb1 UTSW 1 139241138 missense probably damaging 1.00
R1729:Crb1 UTSW 1 139242995 missense probably damaging 1.00
R1729:Crb1 UTSW 1 139243417 missense probably benign 0.00
R1730:Crb1 UTSW 1 139234779 missense probably benign
R1730:Crb1 UTSW 1 139237622 missense probably benign 0.00
R1730:Crb1 UTSW 1 139241138 missense probably damaging 1.00
R1730:Crb1 UTSW 1 139242995 missense probably damaging 1.00
R1730:Crb1 UTSW 1 139243417 missense probably benign 0.00
R1739:Crb1 UTSW 1 139234779 missense probably benign
R1739:Crb1 UTSW 1 139237622 missense probably benign 0.00
R1739:Crb1 UTSW 1 139241138 missense probably damaging 1.00
R1739:Crb1 UTSW 1 139242995 missense probably damaging 1.00
R1739:Crb1 UTSW 1 139243417 missense probably benign 0.00
R1762:Crb1 UTSW 1 139234779 missense probably benign
R1762:Crb1 UTSW 1 139237531 missense probably damaging 1.00
R1762:Crb1 UTSW 1 139237622 missense probably benign 0.00
R1762:Crb1 UTSW 1 139241138 missense probably damaging 1.00
R1762:Crb1 UTSW 1 139242995 missense probably damaging 1.00
R1762:Crb1 UTSW 1 139243417 missense probably benign 0.00
R1783:Crb1 UTSW 1 139234779 missense probably benign
R1783:Crb1 UTSW 1 139237622 missense probably benign 0.00
R1783:Crb1 UTSW 1 139241138 missense probably damaging 1.00
R1783:Crb1 UTSW 1 139242995 missense probably damaging 1.00
R1783:Crb1 UTSW 1 139243417 missense probably benign 0.00
R1784:Crb1 UTSW 1 139234779 missense probably benign
R1784:Crb1 UTSW 1 139237622 missense probably benign 0.00
R1784:Crb1 UTSW 1 139241138 missense probably damaging 1.00
R1784:Crb1 UTSW 1 139242995 missense probably damaging 1.00
R1784:Crb1 UTSW 1 139243417 missense probably benign 0.00
R1785:Crb1 UTSW 1 139234779 missense probably benign
R1785:Crb1 UTSW 1 139237622 missense probably benign 0.00
R1785:Crb1 UTSW 1 139241138 missense probably damaging 1.00
R1785:Crb1 UTSW 1 139242995 missense probably damaging 1.00
R1785:Crb1 UTSW 1 139243417 missense probably benign 0.00
R1848:Crb1 UTSW 1 139237012 missense probably damaging 0.97
R1894:Crb1 UTSW 1 139243193 missense probably benign 0.02
R2057:Crb1 UTSW 1 139314750 missense probably damaging 1.00
R2136:Crb1 UTSW 1 139337425 missense probably benign 0.03
R2140:Crb1 UTSW 1 139237012 missense probably benign 0.01
R2363:Crb1 UTSW 1 139337278 missense possibly damaging 0.89
R3605:Crb1 UTSW 1 139237339 missense probably damaging 1.00
R3817:Crb1 UTSW 1 139248097 missense probably benign
R3942:Crb1 UTSW 1 139337473 missense possibly damaging 0.49
R4272:Crb1 UTSW 1 139323311 missense probably benign 0.04
R4301:Crb1 UTSW 1 139248830 missense probably benign 0.01
R4403:Crb1 UTSW 1 139248379 missense probably benign 0.00
R4700:Crb1 UTSW 1 139198771 missense probably damaging 0.96
R4771:Crb1 UTSW 1 139328204 missense probably damaging 1.00
R4845:Crb1 UTSW 1 139243034 missense probably benign 0.06
R4867:Crb1 UTSW 1 139243014 missense probably damaging 1.00
R5159:Crb1 UTSW 1 139243018 missense probably damaging 0.99
R5270:Crb1 UTSW 1 139236864 missense probably damaging 0.97
R5347:Crb1 UTSW 1 139337371 missense probably damaging 1.00
R5513:Crb1 UTSW 1 139236821 critical splice donor site probably null
R5641:Crb1 UTSW 1 139248889 missense probably damaging 0.99
R5754:Crb1 UTSW 1 139231599 missense probably damaging 1.00
R5968:Crb1 UTSW 1 139243001 missense probably damaging 1.00
R6122:Crb1 UTSW 1 139248948 nonsense probably null
R6369:Crb1 UTSW 1 139237462 missense probably damaging 1.00
R6809:Crb1 UTSW 1 139243126 missense probably benign 0.00
R7020:Crb1 UTSW 1 139231603 missense possibly damaging 0.85
R7072:Crb1 UTSW 1 139237275 missense probably damaging 1.00
R7073:Crb1 UTSW 1 139248311 missense probably damaging 0.99
R7135:Crb1 UTSW 1 139243367 missense probably damaging 0.97
R7493:Crb1 UTSW 1 139237030 missense probably damaging 1.00
R7554:Crb1 UTSW 1 139337281 missense probably damaging 1.00
R7593:Crb1 UTSW 1 139237240 missense probably damaging 1.00
R7740:Crb1 UTSW 1 139237690 missense probably benign 0.01
R7912:Crb1 UTSW 1 139243171 missense probably damaging 1.00
R7993:Crb1 UTSW 1 139243171 missense probably damaging 1.00
R8036:Crb1 UTSW 1 139237384 missense probably benign 0.07
R8042:Crb1 UTSW 1 139314654 missense probably damaging 0.99
X0066:Crb1 UTSW 1 139248245 missense probably benign 0.10
Z1176:Crb1 UTSW 1 139237086 frame shift probably null
Z1177:Crb1 UTSW 1 139237086 frame shift probably null
Z1177:Crb1 UTSW 1 139248901 missense possibly damaging 0.80
Z1177:Crb1 UTSW 1 139337028 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CAAATACCAGCATAAGTCCTGAGGG -3'
(R):5'- TGGCTTACCAATGGGGACAG -3'

Sequencing Primer
(F):5'- CCTTATGTTTCCTAACAGGGGACG -3'
(R):5'- GGACAGCCAACAACAGTGTGTC -3'
Posted On2019-10-17