Mutagenetix > Incidental Mutation

Incidental Mutation 'R0617:Nbeal1'

58377

Institutional Source

Beutler Lab

Gene Symbol

Nbeal1

Ensembl Gene

ENSMUSG00000073664

Gene Name

neurobeachin like 1

Synonyms

A530083I02Rik, A530050O19Rik, ALS2CR17, 2310076G13Rik

MMRRC Submission

038806-MU

Accession Numbers

Genbank: NM_173444; MGI: 2444343

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0617 (G1)

Quality Score

217

Status

Validated

Chromosome

Chromosomal Location

60180599-60338328 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 60281832 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Stop codon at position 2034 (W2034*)

Ref Sequence

ENSEMBL: ENSMUSP00000124056 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000160834] [ENSMUST00000162291]

AlphaFold

E9PYP2

Predicted Effect

probably null
Transcript: ENSMUST00000035569
AA Change: W767*

SMART Domains

Protein: ENSMUSP00000049393
Gene: ENSMUSG00000073664
AA Change: W767*

Domain	Start	End	E-Value	Type
low complexity region	522	541	N/A	INTRINSIC
low complexity region	719	735	N/A	INTRINSIC
Pfam:DUF4704	851	1130	3.4e-39	PFAM
low complexity region	1383	1401	N/A	INTRINSIC
Pfam:DUF4800	1575	1828	6.3e-126	PFAM
coiled coil region	1859	1882	N/A	INTRINSIC
Pfam:PH_BEACH	1889	1975	2e-24	PFAM
Beach	1998	2278	7.2e-199	SMART
Blast:Beach	2342	2405	6e-30	BLAST
WD40	2425	2463	5.52e-2	SMART
WD40	2475	2514	4.95e-4	SMART
WD40	2604	2649	7.64e1	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000159344
AA Change: W47*

SMART Domains

Protein: ENSMUSP00000124850
Gene: ENSMUSG00000073664
AA Change: W47*

Domain	Start	End	E-Value	Type
Beach	31	246	4.21e-109	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000160834
AA Change: W2034*

SMART Domains

Protein: ENSMUSP00000124056
Gene: ENSMUSG00000073664
AA Change: W2034*

Domain	Start	End	E-Value	Type
low complexity region	522	541	N/A	INTRINSIC
Pfam:Laminin_G_3	567	801	8.3e-9	PFAM
low complexity region	1383	1401	N/A	INTRINSIC
low complexity region	1849	1865	N/A	INTRINSIC
Pfam:PH_BEACH	1882	1975	4.9e-32	PFAM
Beach	1998	2278	7.2e-199	SMART
Blast:Beach	2342	2405	6e-30	BLAST
WD40	2425	2463	5.52e-2	SMART
WD40	2475	2514	4.95e-4	SMART
WD40	2604	2649	7.64e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000162291

SMART Domains

Protein: ENSMUSP00000125592
Gene: ENSMUSG00000073664

Domain	Start	End	E-Value	Type
low complexity region	114	132	N/A	INTRINSIC
low complexity region	580	596	N/A	INTRINSIC
Pfam:PH_BEACH	613	706	9.6e-33	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188450

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000190958

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.6%
20x: 95.5%

Validation Efficiency

98% (130/133)

Allele List at MGI

All alleles(16) : Targeted(1) Gene trapped(15)

Other mutations in this stock

Total: 130 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017D01Rik	C	A	19: 11,112,400	L40F	probably damaging	Het
4930555F03Rik	A	T	8: 49,500,492		noncoding transcript	Het
A630073D07Rik	T	C	6: 132,626,737		probably benign	Het
Abca16	G	A	7: 120,433,611		probably benign	Het
Abca5	A	T	11: 110,279,689	D1265E	probably damaging	Het
Abcf1	C	T	17: 35,961,187	V312I	probably benign	Het
Abhd12	T	A	2: 150,846,365		probably null	Het
Adam23	A	G	1: 63,543,147	H318R	probably benign	Het
Adcy2	T	A	13: 68,678,606	K660*	probably null	Het
Adgrf3	T	C	5: 30,195,080	T972A	probably benign	Het
Adipoq	T	A	16: 23,155,410	D62E	probably damaging	Het
Akap2	T	C	4: 57,829,434		probably benign	Het
Alk	G	T	17: 72,603,583	P43T	probably damaging	Het
Arap2	AT	ATT	5: 62,649,907		probably benign	Het
Arhgef28	G	T	13: 97,970,355	T687K	probably benign	Het
Arrb1	T	C	7: 99,594,677	L278P	probably damaging	Het
Atad2b	C	A	12: 4,937,401	D76E	probably benign	Het
Atm	A	T	9: 53,458,941	Y2290*	probably null	Het
Atrn	T	A	2: 130,995,085		probably null	Het
Bpifb1	A	G	2: 154,212,947	D253G	possibly damaging	Het
Bpifb9b	C	T	2: 154,319,625	T559M	probably benign	Het
Bsn	T	C	9: 108,107,240	E3205G	unknown	Het
Cacna1c	T	C	6: 118,602,213	Y1599C	probably damaging	Het
Ccdc40	A	G	11: 119,242,804	D590G	probably damaging	Het
Ccdc68	A	G	18: 69,946,552		probably null	Het
Ccdc97	G	A	7: 25,714,420	R279C	probably damaging	Het
Ccm2l	A	G	2: 153,070,900	T120A	probably damaging	Het
Cfap54	T	C	10: 92,829,650		probably benign	Het
Cfh	A	G	1: 140,100,883	S1043P	probably benign	Het
Chil3	T	C	3: 106,155,756	K173E	probably benign	Het
Cib2	T	C	9: 54,554,496	D26G	possibly damaging	Het
Col24a1	T	C	3: 145,314,120	V84A	probably damaging	Het
Csn3	T	C	5: 87,929,871	Y79H	probably benign	Het
Ddx47	T	A	6: 135,017,122	V149E	probably damaging	Het
Dennd5b	A	T	6: 149,033,262		probably benign	Het
Desi1	T	C	15: 81,998,198	N109D	probably damaging	Het
Fam13c	T	C	10: 70,536,352		probably benign	Het
Fam234a	A	T	17: 26,216,617	D264E	probably benign	Het
Fanca	A	G	8: 123,288,070	F831S	probably damaging	Het
Fancm	C	T	12: 65,097,317	R518*	probably null	Het
Fat2	A	G	11: 55,311,843	V135A	possibly damaging	Het
Fbxl17	A	C	17: 63,384,992	F42V	probably damaging	Het
Fgd3	A	T	13: 49,264,697	V631E	possibly damaging	Het
Fhod3	G	A	18: 25,112,679		probably benign	Het
Focad	T	C	4: 88,121,288		probably benign	Het
Foxn4	C	A	5: 114,261,068		probably benign	Het
Gm1673	T	C	5: 33,983,552		probably benign	Het
Gm2381	A	T	7: 42,819,978	C241S	probably damaging	Het
Gm6483	T	G	8: 19,693,709	F117V	probably damaging	Het
Hectd4	T	C	5: 121,343,232		probably benign	Het
Hecw1	T	A	13: 14,280,442	Q676L	probably benign	Het
Hipk2	G	A	6: 38,747,485	R437C	possibly damaging	Het
Ifnar1	T	C	16: 91,501,682	Y396H	probably damaging	Het
Ints5	A	T	19: 8,896,019	K447N	probably damaging	Het
Iqsec1	T	C	6: 90,689,970	Y495C	probably damaging	Het
Itga5	C	T	15: 103,356,315		probably null	Het
Kcnk4	T	A	19: 6,928,160		probably benign	Het
Kmo	A	G	1: 175,647,190	T174A	possibly damaging	Het
Krt36	T	C	11: 100,102,275	D458G	probably damaging	Het
Krtap16-1	G	T	11: 99,986,495	P28T	probably damaging	Het
Lama3	T	C	18: 12,419,258		probably null	Het
Lrrc9	T	C	12: 72,483,014	S920P	probably damaging	Het
Lrrk2	A	T	15: 91,752,278	Y1485F	probably benign	Het
Mical1	C	T	10: 41,481,315	A372V	probably damaging	Het
Mtr	C	T	13: 12,221,432	R636Q	probably benign	Het
Muc4	A	T	16: 32,752,107	T662S	possibly damaging	Het
Myo10	G	A	15: 25,738,005	V546M	probably damaging	Het
Nhlrc3	T	C	3: 53,458,623	T150A	probably damaging	Het
Nkx2-1	T	C	12: 56,534,855	H69R	possibly damaging	Het
Nlrp4g	A	T	9: 124,349,540		noncoding transcript	Het
Nod2	A	G	8: 88,653,231	N120S	probably benign	Het
Nol8	T	C	13: 49,654,445	F46L	possibly damaging	Het
Ntrk1	T	C	3: 87,783,933	D308G	possibly damaging	Het
Olfr1036	A	G	2: 86,075,141	M134V	probably benign	Het
Olfr1124	A	G	2: 87,434,661	D58G	probably damaging	Het
Olfr1196	A	G	2: 88,700,696	V211A	probably damaging	Het
Olfr1459	T	C	19: 13,146,363	M99V	probably benign	Het
Olfr1477	C	A	19: 13,502,536	N64K	probably damaging	Het
Olfr313	T	C	11: 58,817,149	V47A	probably damaging	Het
Olfr466	A	T	13: 65,152,878	Y218F	possibly damaging	Het
Olfr640	A	T	7: 104,021,989	S110T	probably damaging	Het
Oog3	A	T	4: 144,160,214	V112D	probably benign	Het
Pcdhb8	C	T	18: 37,357,047	R593C	probably benign	Het
Pgm3	A	G	9: 86,556,190		probably null	Het
Pirt	T	A	11: 66,926,172	V103E	probably damaging	Het
Plxnc1	T	A	10: 94,799,368	D1332V	probably damaging	Het
Ppfia4	A	T	1: 134,328,780	V122E	probably damaging	Het
Pramef17	A	G	4: 143,993,518		probably benign	Het
Prmt2	C	T	10: 76,208,683		probably benign	Het
Prrc2a	G	T	17: 35,153,560	P1702T	probably damaging	Het
Prss39	A	T	1: 34,500,198	H173L	probably damaging	Het
Rabl6	A	G	2: 25,586,866		probably null	Het
Rb1cc1	T	A	1: 6,248,790	I794K	possibly damaging	Het
Reln	T	C	5: 21,920,537	D2716G	probably damaging	Het
Sbf2	ACC	AC	7: 110,330,683		probably null	Het
Sema6d	T	A	2: 124,660,745	F583L	possibly damaging	Het
Setx	T	A	2: 29,146,807	H1101Q	possibly damaging	Het
Sis	A	G	3: 72,965,605	C67R	probably damaging	Het
Skint1	T	A	4: 112,029,399		probably benign	Het
Smg6	C	A	11: 75,162,931	T1413K	probably benign	Het
Spata31d1a	A	T	13: 59,702,259	I685N	possibly damaging	Het
Spef2	T	A	15: 9,592,758	N1499I	probably damaging	Het
Stk11ip	T	A	1: 75,532,288		probably null	Het
Stxbp1	A	C	2: 32,802,783	I407S	probably damaging	Het
Svil	T	C	18: 5,117,002	S2059P	probably damaging	Het
Syne1	C	T	10: 5,350,933	V932M	probably damaging	Het
Tacc1	A	C	8: 25,178,004		probably benign	Het
Tbc1d13	C	A	2: 30,135,564		probably benign	Het
Tbc1d15	A	C	10: 115,239,299	D59E	probably damaging	Het
Tcaf2	A	G	6: 42,642,511	F194S	probably damaging	Het
Terf2ip	T	A	8: 112,011,495	M5K	probably benign	Het
Tgfbr2	A	T	9: 116,158,320	D40E	probably benign	Het
Tm4sf5	T	A	11: 70,510,669	S165T	probably damaging	Het
Tmprss3	A	T	17: 31,193,912	C129S	probably damaging	Het
Tmx2	T	C	2: 84,672,396	D256G	probably benign	Het
Tnr	A	G	1: 159,868,103	D532G	probably damaging	Het
Tnrc18	T	A	5: 142,776,739	H465L	unknown	Het
Togaram2	A	T	17: 71,700,509	Q350L	possibly damaging	Het
Topaz1	G	A	9: 122,749,906	C627Y	possibly damaging	Het
Tpx2	A	T	2: 152,873,138	Q93L	probably benign	Het
Trim54	T	C	5: 31,136,182		probably null	Het
Troap	T	A	15: 99,082,660	C574S	probably damaging	Het
Ubr4	T	C	4: 139,479,062		probably null	Het
Vmn2r51	A	G	7: 10,100,469	V214A	possibly damaging	Het
Vmn2r66	A	T	7: 84,995,276	M642K	probably benign	Het
Vwa5a	T	A	9: 38,723,895	I232N	probably damaging	Het
Zcchc6	A	T	13: 59,816,855		probably null	Het
Zfp820	A	T	17: 21,819,704	S214R	probably damaging	Het
Zfp955b	A	T	17: 33,305,463	S43R	probably damaging	Het
Zgrf1	C	T	3: 127,588,038	T1162M	probably benign	Het

Other mutations in Nbeal1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00094:Nbeal1	APN	1	60235191	nonsense	probably null	0.00
IGL00334:Nbeal1	APN	1	60281883	missense	probably damaging	0.98
IGL00334:Nbeal1	APN	1	60328103	missense	probably damaging	1.00
IGL00514:Nbeal1	APN	1	60217225	missense	probably benign	0.31
IGL00596:Nbeal1	APN	1	60181741	missense	probably damaging	0.96
IGL00654:Nbeal1	APN	1	60195011	critical splice acceptor site	probably benign	0.00
IGL00757:Nbeal1	APN	1	60195143	missense	possibly damaging	0.82
IGL00771:Nbeal1	APN	1	60235353	missense	probably benign	0.11
IGL01315:Nbeal1	APN	1	60281341	missense	probably damaging	1.00
IGL01445:Nbeal1	APN	1	60242625	critical splice donor site	probably null
IGL01456:Nbeal1	APN	1	60230628	missense	probably damaging	1.00
IGL01458:Nbeal1	APN	1	60242625	critical splice donor site	probably null
IGL01535:Nbeal1	APN	1	60217255	missense	probably damaging	1.00
IGL01608:Nbeal1	APN	1	60242535	critical splice acceptor site	probably benign	0.00
IGL02006:Nbeal1	APN	1	60272259	critical splice donor site	probably null
IGL02105:Nbeal1	APN	1	60253501	missense	probably damaging	1.00
IGL02409:Nbeal1	APN	1	60329335	missense	probably benign	0.01
IGL02713:Nbeal1	APN	1	60235237	missense	possibly damaging	0.94
IGL02720:Nbeal1	APN	1	60283987	missense	probably damaging	0.98
IGL02887:Nbeal1	APN	1	60287444	splice site	probably benign
IGL02945:Nbeal1	APN	1	60206410	missense	probably damaging	1.00
IGL03023:Nbeal1	APN	1	60253413	missense	probably damaging	0.98
IGL03114:Nbeal1	APN	1	60278727	missense	probably damaging	1.00
IGL03231:Nbeal1	APN	1	60236459	missense	probably benign	0.44
IGL03241:Nbeal1	APN	1	60234868	missense	possibly damaging	0.46
IGL03241:Nbeal1	APN	1	60234869	missense	probably benign	0.44
IGL03382:Nbeal1	APN	1	60261586	critical splice donor site	probably null
IGL03412:Nbeal1	APN	1	60242567	nonsense	probably null
coach	UTSW	1	60253481	nonsense	probably null
Committee	UTSW	1	60292903	missense	probably damaging	1.00
Disgrace	UTSW	1	60281310	nonsense	probably null
Dravrah	UTSW	1	60284092	missense	probably damaging	1.00
Harvard	UTSW	1	60235563	splice site	probably null
horrified	UTSW	1	60244824	missense	probably damaging	1.00
Lampoon	UTSW	1	60261586	critical splice donor site	probably null
lawyer	UTSW	1	60310224	nonsense	probably null
magistrate	UTSW	1	60194597	critical splice donor site	probably null
Maratimus	UTSW	1	60291888	missense	probably damaging	1.00
National	UTSW	1	60222263	missense	possibly damaging	0.95
phainopepla	UTSW	1	60319687	missense	probably damaging	1.00
R3875_Nbeal1_770	UTSW	1	60194599	splice site	probably benign
satirical	UTSW	1	60235562	critical splice donor site	probably null
silky	UTSW	1	60330878	splice site	probably benign
stiggs	UTSW	1	60237151	missense	probably benign	0.11
3-1:Nbeal1	UTSW	1	60264272	splice site	probably benign
P0007:Nbeal1	UTSW	1	60319688	missense	probably damaging	0.98
P0028:Nbeal1	UTSW	1	60291937	missense	probably damaging	1.00
R0041:Nbeal1	UTSW	1	60281871	missense	probably benign	0.05
R0051:Nbeal1	UTSW	1	60310263	missense	probably benign	0.19
R0052:Nbeal1	UTSW	1	60228612	splice site	probably benign
R0054:Nbeal1	UTSW	1	60287401	utr 3 prime	probably benign
R0062:Nbeal1	UTSW	1	60247717	missense	probably benign	0.01
R0062:Nbeal1	UTSW	1	60247717	missense	probably benign	0.01
R0094:Nbeal1	UTSW	1	60305309	missense	possibly damaging	0.62
R0310:Nbeal1	UTSW	1	60305370	splice site	probably benign
R0324:Nbeal1	UTSW	1	60292873	missense	probably damaging	1.00
R0329:Nbeal1	UTSW	1	60268063	missense	probably damaging	1.00
R0330:Nbeal1	UTSW	1	60268063	missense	probably damaging	1.00
R0417:Nbeal1	UTSW	1	60247734	missense	probably benign	0.00
R0421:Nbeal1	UTSW	1	60268439	missense	probably benign	0.08
R1034:Nbeal1	UTSW	1	60290006	nonsense	probably null
R1082:Nbeal1	UTSW	1	60312226	missense	probably damaging	0.99
R1123:Nbeal1	UTSW	1	60260269	missense	probably benign
R1187:Nbeal1	UTSW	1	60194528	missense	probably damaging	1.00
R1484:Nbeal1	UTSW	1	60200939	missense	probably damaging	1.00
R1594:Nbeal1	UTSW	1	60305291	missense	possibly damaging	0.91
R1651:Nbeal1	UTSW	1	60200119	missense	probably damaging	1.00
R1678:Nbeal1	UTSW	1	60260334	missense	probably benign	0.00
R1806:Nbeal1	UTSW	1	60284092	missense	probably damaging	1.00
R1937:Nbeal1	UTSW	1	60267941	nonsense	probably null
R1952:Nbeal1	UTSW	1	60234840	missense	probably damaging	1.00
R1953:Nbeal1	UTSW	1	60234840	missense	probably damaging	1.00
R2038:Nbeal1	UTSW	1	60206344	missense	probably benign	0.00
R2044:Nbeal1	UTSW	1	60319687	missense	probably damaging	1.00
R2050:Nbeal1	UTSW	1	60292964	splice site	probably null
R2055:Nbeal1	UTSW	1	60311057	missense	probably damaging	1.00
R2064:Nbeal1	UTSW	1	60270356	missense	possibly damaging	0.89
R2100:Nbeal1	UTSW	1	60305271	splice site	probably null
R2181:Nbeal1	UTSW	1	60278780	missense	probably damaging	1.00
R2192:Nbeal1	UTSW	1	60281895	missense	probably damaging	1.00
R2203:Nbeal1	UTSW	1	60284006	missense	probably benign	0.21
R2267:Nbeal1	UTSW	1	60330878	splice site	probably benign
R2268:Nbeal1	UTSW	1	60330878	splice site	probably benign
R2351:Nbeal1	UTSW	1	60237098	missense	possibly damaging	0.90
R2366:Nbeal1	UTSW	1	60251352	missense	probably damaging	0.97
R2393:Nbeal1	UTSW	1	60251370	missense	probably damaging	0.98
R3545:Nbeal1	UTSW	1	60278780	missense	probably damaging	1.00
R3546:Nbeal1	UTSW	1	60278780	missense	probably damaging	1.00
R3547:Nbeal1	UTSW	1	60278780	missense	probably damaging	1.00
R3701:Nbeal1	UTSW	1	60251413	splice site	probably benign
R3747:Nbeal1	UTSW	1	60195023	missense	probably damaging	0.98
R3875:Nbeal1	UTSW	1	60194599	splice site	probably benign
R4119:Nbeal1	UTSW	1	60291870	missense	probably damaging	0.99
R4256:Nbeal1	UTSW	1	60330948	missense	probably benign	0.19
R4371:Nbeal1	UTSW	1	60289946	missense	possibly damaging	0.95
R4450:Nbeal1	UTSW	1	60267774	missense	probably damaging	0.97
R4558:Nbeal1	UTSW	1	60281310	nonsense	probably null
R4618:Nbeal1	UTSW	1	60228731	intron	probably benign
R4673:Nbeal1	UTSW	1	60329390	missense	probably damaging	1.00
R4719:Nbeal1	UTSW	1	60235563	splice site	probably null
R4798:Nbeal1	UTSW	1	60222193	splice site	probably null
R4826:Nbeal1	UTSW	1	60251342	missense	possibly damaging	0.79
R4841:Nbeal1	UTSW	1	60253375	missense	probably damaging	1.00
R4842:Nbeal1	UTSW	1	60253375	missense	probably damaging	1.00
R4895:Nbeal1	UTSW	1	60292903	missense	probably damaging	1.00
R4929:Nbeal1	UTSW	1	60238654	missense	probably damaging	1.00
R5026:Nbeal1	UTSW	1	60237179	missense	probably damaging	1.00
R5243:Nbeal1	UTSW	1	60270328	missense	probably damaging	0.99
R5300:Nbeal1	UTSW	1	60235559	nonsense	probably null
R5345:Nbeal1	UTSW	1	60328210	critical splice donor site	probably null
R5502:Nbeal1	UTSW	1	60310999	missense	probably damaging	1.00
R5542:Nbeal1	UTSW	1	60277194	missense	probably benign	0.00
R5555:Nbeal1	UTSW	1	60237152	missense	possibly damaging	0.93
R5580:Nbeal1	UTSW	1	60242602	missense	probably benign	0.45
R5765:Nbeal1	UTSW	1	60291847	missense	probably damaging	1.00
R5802:Nbeal1	UTSW	1	60272221	missense	probably benign	0.01
R5907:Nbeal1	UTSW	1	60228791	intron	probably benign
R5918:Nbeal1	UTSW	1	60267892	missense	possibly damaging	0.90
R5923:Nbeal1	UTSW	1	60248395	missense	probably damaging	1.00
R6066:Nbeal1	UTSW	1	60248405	missense	probably benign	0.29
R6091:Nbeal1	UTSW	1	60181556	start gained	probably benign
R6113:Nbeal1	UTSW	1	60222263	missense	possibly damaging	0.95
R6143:Nbeal1	UTSW	1	60251307	missense	possibly damaging	0.81
R6194:Nbeal1	UTSW	1	60257484	missense	possibly damaging	0.80
R6197:Nbeal1	UTSW	1	60222128	missense	probably damaging	0.99
R6228:Nbeal1	UTSW	1	60295924	missense	probably benign	0.00
R6229:Nbeal1	UTSW	1	60248365	missense	possibly damaging	0.88
R6309:Nbeal1	UTSW	1	60238719	missense	probably benign
R6457:Nbeal1	UTSW	1	60253474	missense	probably benign	0.31
R6489:Nbeal1	UTSW	1	60330942	missense	possibly damaging	0.89
R6845:Nbeal1	UTSW	1	60281310	nonsense	probably null
R7021:Nbeal1	UTSW	1	60261586	critical splice donor site	probably null
R7033:Nbeal1	UTSW	1	60310947	missense	probably damaging	1.00
R7144:Nbeal1	UTSW	1	60237151	missense	probably benign	0.11
R7145:Nbeal1	UTSW	1	60237151	missense	probably benign	0.11
R7146:Nbeal1	UTSW	1	60237151	missense	probably benign	0.11
R7157:Nbeal1	UTSW	1	60237158	missense	probably damaging	1.00
R7157:Nbeal1	UTSW	1	60260634	nonsense	probably null
R7209:Nbeal1	UTSW	1	60237151	missense	probably benign	0.11
R7210:Nbeal1	UTSW	1	60237151	missense	probably benign	0.11
R7211:Nbeal1	UTSW	1	60200951	missense	probably damaging	1.00
R7212:Nbeal1	UTSW	1	60237151	missense	probably benign	0.11
R7213:Nbeal1	UTSW	1	60237151	missense	probably benign	0.11
R7214:Nbeal1	UTSW	1	60237151	missense	probably benign	0.11
R7283:Nbeal1	UTSW	1	60237151	missense	probably benign	0.11
R7285:Nbeal1	UTSW	1	60237151	missense	probably benign	0.11
R7287:Nbeal1	UTSW	1	60237151	missense	probably benign	0.11
R7296:Nbeal1	UTSW	1	60310224	nonsense	probably null
R7312:Nbeal1	UTSW	1	60237151	missense	probably benign	0.11
R7313:Nbeal1	UTSW	1	60237151	missense	probably benign	0.11
R7329:Nbeal1	UTSW	1	60217196	missense	probably benign	0.39
R7380:Nbeal1	UTSW	1	60244810	missense	probably damaging	1.00
R7414:Nbeal1	UTSW	1	60194597	critical splice donor site	probably null
R7477:Nbeal1	UTSW	1	60261584	missense	probably benign
R7507:Nbeal1	UTSW	1	60235467	missense	probably damaging	1.00
R7642:Nbeal1	UTSW	1	60277227	missense	probably benign	0.31
R7678:Nbeal1	UTSW	1	60237151	missense	probably benign	0.11
R7689:Nbeal1	UTSW	1	60237151	missense	probably benign	0.11
R7728:Nbeal1	UTSW	1	60244824	missense	probably damaging	1.00
R7757:Nbeal1	UTSW	1	60257450	missense	probably damaging	0.97
R7761:Nbeal1	UTSW	1	60319341	missense	probably benign	0.00
R7813:Nbeal1	UTSW	1	60291889	missense	probably damaging	1.00
R7829:Nbeal1	UTSW	1	60237151	missense	probably benign	0.11
R7891:Nbeal1	UTSW	1	60260432	missense	probably benign
R7902:Nbeal1	UTSW	1	60291870	missense	probably damaging	0.99
R8022:Nbeal1	UTSW	1	60260272	nonsense	probably null
R8053:Nbeal1	UTSW	1	60279795	missense	probably damaging	0.98
R8169:Nbeal1	UTSW	1	60237151	missense	probably benign	0.11
R8170:Nbeal1	UTSW	1	60237151	missense	probably benign	0.11
R8178:Nbeal1	UTSW	1	60237151	missense	probably benign	0.11
R8182:Nbeal1	UTSW	1	60200133	missense	probably benign	0.00
R8186:Nbeal1	UTSW	1	60237151	missense	probably benign	0.11
R8187:Nbeal1	UTSW	1	60237151	missense	probably benign	0.11
R8193:Nbeal1	UTSW	1	60253481	nonsense	probably null
R8209:Nbeal1	UTSW	1	60277177	missense	probably damaging	0.99
R8226:Nbeal1	UTSW	1	60277177	missense	probably damaging	0.99
R8549:Nbeal1	UTSW	1	60235562	critical splice donor site	probably null
R8560:Nbeal1	UTSW	1	60235157	missense	probably benign	0.38
R8753:Nbeal1	UTSW	1	60268383	missense	probably damaging	1.00
R8769:Nbeal1	UTSW	1	60235211	missense	probably damaging	0.99
R8771:Nbeal1	UTSW	1	60261584	missense	probably benign
R8952:Nbeal1	UTSW	1	60260300	missense	probably benign	0.01
R9014:Nbeal1	UTSW	1	60289959	missense	probably damaging	1.00
R9056:Nbeal1	UTSW	1	60278726	missense	probably damaging	1.00
R9091:Nbeal1	UTSW	1	60268389	missense	possibly damaging	0.50
R9138:Nbeal1	UTSW	1	60247745	nonsense	probably null
R9168:Nbeal1	UTSW	1	60291888	missense	probably damaging	1.00
R9200:Nbeal1	UTSW	1	60281266	missense	probably damaging	1.00
R9205:Nbeal1	UTSW	1	60278680	missense	probably damaging	1.00
R9270:Nbeal1	UTSW	1	60268389	missense	possibly damaging	0.50
R9322:Nbeal1	UTSW	1	60258659	missense	possibly damaging	0.91
R9405:Nbeal1	UTSW	1	60310265	missense	probably damaging	1.00
R9554:Nbeal1	UTSW	1	60251128	nonsense	probably null
R9557:Nbeal1	UTSW	1	60235350	missense	probably benign
R9560:Nbeal1	UTSW	1	60329385	missense	probably damaging	1.00
R9641:Nbeal1	UTSW	1	60311088	missense	probably damaging	1.00
R9784:Nbeal1	UTSW	1	60260582	nonsense	probably null
X0022:Nbeal1	UTSW	1	60277232	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TGCACAGTACCCTGTGGTGAGT -3'
(R):5'- CAGAGAACATgaagctggagagatgg -3'

Sequencing Primer
(F):5'- tgtactgtatgtgaggctctg -3'
(R):5'- agacaaaacaaccatacacattaaag -3'

Posted On

2013-07-11