Incidental Mutation 'R7539:Olfr444'
ID583774
Institutional Source Beutler Lab
Gene Symbol Olfr444
Ensembl Gene ENSMUSG00000073110
Gene Nameolfactory receptor 444
SynonymsMOR261-2, GA_x6K02T2P3E9-4602571-4601639
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R7539 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location42949067-42956764 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 42956103 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 202 (C202R)
Ref Sequence ENSEMBL: ENSMUSP00000144691 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095955] [ENSMUST00000204092]
Predicted Effect possibly damaging
Transcript: ENSMUST00000095955
AA Change: C202R

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000093649
Gene: ENSMUSG00000073110
AA Change: C202R

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 1e-60 PFAM
Pfam:7tm_1 40 289 6.1e-26 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000204092
AA Change: C202R

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000144691
Gene: ENSMUSG00000073110
AA Change: C202R

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 8.6e-60 PFAM
Pfam:7tm_1 40 289 3.5e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,201,244 I1002V probably benign Het
4930516K23Rik T C 7: 104,059,263 E113G probably damaging Het
Abcf3 T C 16: 20,552,632 probably null Het
Agbl1 T C 7: 76,425,929 probably null Het
Ap5m1 C A 14: 49,073,557 P28Q probably damaging Het
Bet1l T C 7: 140,854,544 D83G probably benign Het
Birc6 T C 17: 74,649,696 S3571P probably damaging Het
Bod1l A T 5: 41,817,860 M2037K possibly damaging Het
Ccdc80 A T 16: 45,095,082 E67V probably benign Het
Cep112 A G 11: 108,855,828 M133V probably benign Het
Ckmt2 C A 13: 91,859,944 D224Y probably damaging Het
Crb1 T G 1: 139,248,229 K672T probably damaging Het
Dnhd1 T C 7: 105,720,912 S4515P probably damaging Het
Dock9 A G 14: 121,581,436 S1545P probably damaging Het
Dopey1 T G 9: 86,521,573 S145A probably benign Het
Eps8l1 T C 7: 4,470,037 S92P probably damaging Het
Faap100 T C 11: 120,377,638 D103G possibly damaging Het
Fech T A 18: 64,483,494 probably null Het
Folh1 T A 7: 86,725,909 E623V probably benign Het
Galnt5 T C 2: 58,035,230 L841P probably damaging Het
Ggh C G 4: 20,049,833 S88C probably damaging Het
Gm10577 C T 4: 101,020,696 V1I unknown Het
Grip1 T A 10: 120,054,871 H938Q probably benign Het
Gucy2g G A 19: 55,203,154 A955V probably damaging Het
Hpd G C 5: 123,178,192 Y165* probably null Het
Iqsec1 C A 6: 90,662,891 R955L probably benign Het
Masp1 A T 16: 23,470,378 H557Q possibly damaging Het
Muc4 C T 16: 32,756,396 T20M Het
Myo16 T C 8: 10,361,095 probably null Het
Nfkb2 T C 19: 46,308,223 F273L possibly damaging Het
Olfr1299 T C 2: 111,664,433 V69A possibly damaging Het
Olfr1489 C T 19: 13,633,569 Q153* probably null Het
Olfr323 A T 11: 58,625,956 I29N probably damaging Het
Olfr355 T C 2: 36,927,209 R302G probably benign Het
Olfr594 T C 7: 103,220,066 V116A possibly damaging Het
Olfr598 A G 7: 103,328,494 S3G probably benign Het
Olfr791 A T 10: 129,527,105 K293* probably null Het
Olfr816 T C 10: 129,912,063 T72A probably damaging Het
Olfr868 A T 9: 20,101,619 M287L probably benign Het
Parp4 T A 14: 56,635,755 I1152N probably damaging Het
Peg3 T C 7: 6,708,168 T1352A probably benign Het
Pik3c2a T C 7: 116,340,096 N1669S probably damaging Het
Pinx1 A T 14: 63,919,206 Q194L probably benign Het
Podxl2 A C 6: 88,849,329 S268A probably benign Het
Polr2c C A 8: 94,870,779 H363N unknown Het
Prlr C T 15: 10,329,023 T528I probably benign Het
Rab37 A C 11: 115,160,661 Q198P probably benign Het
Rrm2b T A 15: 37,937,351 probably null Het
Serpina3b T C 12: 104,130,711 S84P possibly damaging Het
Slc9a3r2 G T 17: 24,641,899 A223D probably damaging Het
Stat4 A T 1: 52,071,709 probably null Het
Them6 T C 15: 74,723,500 I185T probably damaging Het
Tmco4 T A 4: 139,021,699 M316K probably benign Het
Tmtc4 G T 14: 122,978,289 probably null Het
Tnni3k A T 3: 154,962,031 N248K probably benign Het
Trim43a T A 9: 88,583,043 L141Q probably benign Het
Utp20 C T 10: 88,791,745 V953M probably damaging Het
Vmn2r118 T A 17: 55,592,853 T684S probably damaging Het
Wasl A T 6: 24,619,198 I441N unknown Het
Wfikkn2 T C 11: 94,242,359 D64G probably damaging Het
Zfp128 C A 7: 12,890,552 Y282* probably null Het
Other mutations in Olfr444
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Olfr444 APN 6 42956436 utr 3 prime probably benign
IGL02135:Olfr444 APN 6 42955651 missense probably damaging 0.99
IGL02323:Olfr444 APN 6 42955983 missense probably benign 0.02
IGL02398:Olfr444 APN 6 42956112 missense probably benign 0.02
IGL02622:Olfr444 APN 6 42955729 missense probably damaging 0.99
R0077:Olfr444 UTSW 6 42955773 missense probably benign 0.13
R0416:Olfr444 UTSW 6 42955570 missense probably benign
R0959:Olfr444 UTSW 6 42955752 missense probably benign
R1181:Olfr444 UTSW 6 42955558 missense probably benign 0.23
R1347:Olfr444 UTSW 6 42955705 missense probably damaging 1.00
R1347:Olfr444 UTSW 6 42955705 missense probably damaging 1.00
R1604:Olfr444 UTSW 6 42955716 missense possibly damaging 0.73
R3021:Olfr444 UTSW 6 42956184 missense possibly damaging 0.91
R4226:Olfr444 UTSW 6 42955755 missense probably benign
R4227:Olfr444 UTSW 6 42955714 missense possibly damaging 0.95
R4776:Olfr444 UTSW 6 42955521 missense probably benign 0.00
R5941:Olfr444 UTSW 6 42955716 missense possibly damaging 0.86
R7763:Olfr444 UTSW 6 42955789 missense probably benign 0.00
X0063:Olfr444 UTSW 6 42956019 missense possibly damaging 0.64
Z1176:Olfr444 UTSW 6 42955690 missense probably damaging 1.00
Z1176:Olfr444 UTSW 6 42956298 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- AAGTGTGTACCATCCTGGCAG -3'
(R):5'- GATCTTCTGCTGCAGTTCAGGG -3'

Sequencing Primer
(F):5'- GCAGCTGTCTCCTGGATAG -3'
(R):5'- ATTTAGGGGCCATGTACATGAC -3'
Posted On2019-10-17