Incidental Mutation 'R7539:Zfp128'
ID583779
Institutional Source Beutler Lab
Gene Symbol Zfp128
Ensembl Gene ENSMUSG00000060397
Gene Namezinc finger protein 128
SynonymsmZnf8, 9630016P15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R7539 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location12881177-12893422 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 12890552 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 282 (Y282*)
Ref Sequence ENSEMBL: ENSMUSP00000115378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000144578]
Predicted Effect probably null
Transcript: ENSMUST00000144578
AA Change: Y282*
SMART Domains Protein: ENSMUSP00000115378
Gene: ENSMUSG00000060397
AA Change: Y282*

DomainStartEndE-ValueType
KRAB 25 85 2.51e-38 SMART
ZnF_C2H2 254 276 8.47e-4 SMART
ZnF_C2H2 282 304 5.21e-4 SMART
ZnF_C2H2 310 332 4.17e-3 SMART
ZnF_C2H2 338 360 3.89e-3 SMART
ZnF_C2H2 366 388 1.47e-3 SMART
ZnF_C2H2 394 416 8.47e-4 SMART
ZnF_C2H2 464 486 3.39e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,201,244 I1002V probably benign Het
4930516K23Rik T C 7: 104,059,263 E113G probably damaging Het
Abcf3 T C 16: 20,552,632 probably null Het
Agbl1 T C 7: 76,425,929 probably null Het
Ap5m1 C A 14: 49,073,557 P28Q probably damaging Het
Bet1l T C 7: 140,854,544 D83G probably benign Het
Birc6 T C 17: 74,649,696 S3571P probably damaging Het
Bod1l A T 5: 41,817,860 M2037K possibly damaging Het
Ccdc80 A T 16: 45,095,082 E67V probably benign Het
Cep112 A G 11: 108,855,828 M133V probably benign Het
Ckmt2 C A 13: 91,859,944 D224Y probably damaging Het
Crb1 T G 1: 139,248,229 K672T probably damaging Het
Dnhd1 T C 7: 105,720,912 S4515P probably damaging Het
Dock9 A G 14: 121,581,436 S1545P probably damaging Het
Dopey1 T G 9: 86,521,573 S145A probably benign Het
Eps8l1 T C 7: 4,470,037 S92P probably damaging Het
Faap100 T C 11: 120,377,638 D103G possibly damaging Het
Fech T A 18: 64,483,494 probably null Het
Folh1 T A 7: 86,725,909 E623V probably benign Het
Galnt5 T C 2: 58,035,230 L841P probably damaging Het
Ggh C G 4: 20,049,833 S88C probably damaging Het
Gm10577 C T 4: 101,020,696 V1I unknown Het
Grip1 T A 10: 120,054,871 H938Q probably benign Het
Gucy2g G A 19: 55,203,154 A955V probably damaging Het
Hpd G C 5: 123,178,192 Y165* probably null Het
Iqsec1 C A 6: 90,662,891 R955L probably benign Het
Masp1 A T 16: 23,470,378 H557Q possibly damaging Het
Muc4 C T 16: 32,756,396 T20M Het
Myo16 T C 8: 10,361,095 probably null Het
Nfkb2 T C 19: 46,308,223 F273L possibly damaging Het
Olfr1299 T C 2: 111,664,433 V69A possibly damaging Het
Olfr1489 C T 19: 13,633,569 Q153* probably null Het
Olfr323 A T 11: 58,625,956 I29N probably damaging Het
Olfr355 T C 2: 36,927,209 R302G probably benign Het
Olfr444 T C 6: 42,956,103 C202R possibly damaging Het
Olfr594 T C 7: 103,220,066 V116A possibly damaging Het
Olfr598 A G 7: 103,328,494 S3G probably benign Het
Olfr791 A T 10: 129,527,105 K293* probably null Het
Olfr816 T C 10: 129,912,063 T72A probably damaging Het
Olfr868 A T 9: 20,101,619 M287L probably benign Het
Parp4 T A 14: 56,635,755 I1152N probably damaging Het
Peg3 T C 7: 6,708,168 T1352A probably benign Het
Pik3c2a T C 7: 116,340,096 N1669S probably damaging Het
Pinx1 A T 14: 63,919,206 Q194L probably benign Het
Podxl2 A C 6: 88,849,329 S268A probably benign Het
Polr2c C A 8: 94,870,779 H363N unknown Het
Prlr C T 15: 10,329,023 T528I probably benign Het
Rab37 A C 11: 115,160,661 Q198P probably benign Het
Rrm2b T A 15: 37,937,351 probably null Het
Serpina3b T C 12: 104,130,711 S84P possibly damaging Het
Slc9a3r2 G T 17: 24,641,899 A223D probably damaging Het
Stat4 A T 1: 52,071,709 probably null Het
Them6 T C 15: 74,723,500 I185T probably damaging Het
Tmco4 T A 4: 139,021,699 M316K probably benign Het
Tmtc4 G T 14: 122,978,289 probably null Het
Tnni3k A T 3: 154,962,031 N248K probably benign Het
Trim43a T A 9: 88,583,043 L141Q probably benign Het
Utp20 C T 10: 88,791,745 V953M probably damaging Het
Vmn2r118 T A 17: 55,592,853 T684S probably damaging Het
Wasl A T 6: 24,619,198 I441N unknown Het
Wfikkn2 T C 11: 94,242,359 D64G probably damaging Het
Other mutations in Zfp128
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01140:Zfp128 APN 7 12891022 missense probably benign 0.00
IGL01293:Zfp128 APN 7 12891424 makesense probably null
IGL02067:Zfp128 APN 7 12885050 missense possibly damaging 0.86
IGL02146:Zfp128 APN 7 12890032 missense possibly damaging 0.72
IGL02654:Zfp128 APN 7 12884679 missense possibly damaging 0.95
IGL03066:Zfp128 APN 7 12890117 missense probably benign 0.00
IGL03076:Zfp128 APN 7 12884709 missense possibly damaging 0.95
IGL03113:Zfp128 APN 7 12890387 missense probably benign 0.00
IGL03237:Zfp128 APN 7 12891026 missense probably benign 0.28
R1686_Zfp128_342 UTSW 7 12890636 nonsense probably null
R0783:Zfp128 UTSW 7 12890272 missense probably damaging 1.00
R1686:Zfp128 UTSW 7 12890636 nonsense probably null
R1806:Zfp128 UTSW 7 12891022 missense probably benign 0.00
R2021:Zfp128 UTSW 7 12890029 missense possibly damaging 0.96
R3792:Zfp128 UTSW 7 12884732 missense probably damaging 0.98
R4105:Zfp128 UTSW 7 12884740 missense probably damaging 0.99
R4167:Zfp128 UTSW 7 12890362 missense probably benign 0.28
R4168:Zfp128 UTSW 7 12890362 missense probably benign 0.28
R5743:Zfp128 UTSW 7 12884727 missense probably damaging 1.00
R6266:Zfp128 UTSW 7 12890970 missense possibly damaging 0.80
R6799:Zfp128 UTSW 7 12890899 missense possibly damaging 0.93
R7102:Zfp128 UTSW 7 12890472 missense probably damaging 1.00
R7313:Zfp128 UTSW 7 12890534 missense possibly damaging 0.94
R7428:Zfp128 UTSW 7 12890362 missense probably benign 0.28
R7504:Zfp128 UTSW 7 12890478 missense probably damaging 0.99
R7636:Zfp128 UTSW 7 12890112 missense probably benign
R7755:Zfp128 UTSW 7 12890313 nonsense probably null
R7820:Zfp128 UTSW 7 12891022 missense probably benign 0.00
R8269:Zfp128 UTSW 7 12890736 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTTTGATGACAATGGCAGTC -3'
(R):5'- TCCTCTTGTGTCGACCTAGG -3'

Sequencing Primer
(F):5'- TGGCAGTCAAAAAGCCTTTG -3'
(R):5'- GATGAATTCTGATTGAAGGCCCTCC -3'
Posted On2019-10-17