Incidental Mutation 'R7539:Agbl1'
ID583781
Institutional Source Beutler Lab
Gene Symbol Agbl1
Ensembl Gene ENSMUSG00000025754
Gene NameATP/GTP binding protein-like 1
SynonymsNna1-l1, EG244071
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_001199224.1; MGI:3646469

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7539 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location76229887-77124698 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 76425929 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026854] [ENSMUST00000107442] [ENSMUST00000156166]
Predicted Effect probably null
Transcript: ENSMUST00000026854
SMART Domains Protein: ENSMUSP00000026854
Gene: ENSMUSG00000025754

DomainStartEndE-ValueType
low complexity region 48 64 N/A INTRINSIC
Pfam:Peptidase_M14 493 631 4.4e-22 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000107442
SMART Domains Protein: ENSMUSP00000103066
Gene: ENSMUSG00000025754

DomainStartEndE-ValueType
low complexity region 48 64 N/A INTRINSIC
Pfam:Peptidase_M14 494 754 3.1e-27 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000156166
SMART Domains Protein: ENSMUSP00000119721
Gene: ENSMUSG00000025754

DomainStartEndE-ValueType
low complexity region 254 270 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000128342
Gene: ENSMUSG00000025754

DomainStartEndE-ValueType
low complexity region 286 302 N/A INTRINSIC
Pfam:Peptidase_M14 737 871 7.4e-14 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Polyglutamylation is a reversible posttranslational modification catalyzed by polyglutamylases that results in the addition of glutamate side chains on the modified protein. This gene encodes a glutamate decarboxylase that catalyzes the deglutamylation of polyglutamylated proteins. Mutations in this gene result in dominant late-onset Fuchs corneal dystrophy. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal response to herpes simplex virus (HSV) and vaccinia virus (VACV) infection. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,201,244 I1002V probably benign Het
4930516K23Rik T C 7: 104,059,263 E113G probably damaging Het
Abcf3 T C 16: 20,552,632 probably null Het
Ap5m1 C A 14: 49,073,557 P28Q probably damaging Het
Bet1l T C 7: 140,854,544 D83G probably benign Het
Birc6 T C 17: 74,649,696 S3571P probably damaging Het
Bod1l A T 5: 41,817,860 M2037K possibly damaging Het
Ccdc80 A T 16: 45,095,082 E67V probably benign Het
Cep112 A G 11: 108,855,828 M133V probably benign Het
Ckmt2 C A 13: 91,859,944 D224Y probably damaging Het
Crb1 T G 1: 139,248,229 K672T probably damaging Het
Dnhd1 T C 7: 105,720,912 S4515P probably damaging Het
Dock9 A G 14: 121,581,436 S1545P probably damaging Het
Dopey1 T G 9: 86,521,573 S145A probably benign Het
Eps8l1 T C 7: 4,470,037 S92P probably damaging Het
Faap100 T C 11: 120,377,638 D103G possibly damaging Het
Fech T A 18: 64,483,494 probably null Het
Folh1 T A 7: 86,725,909 E623V probably benign Het
Galnt5 T C 2: 58,035,230 L841P probably damaging Het
Ggh C G 4: 20,049,833 S88C probably damaging Het
Gm10577 C T 4: 101,020,696 V1I unknown Het
Grip1 T A 10: 120,054,871 H938Q probably benign Het
Gucy2g G A 19: 55,203,154 A955V probably damaging Het
Hpd G C 5: 123,178,192 Y165* probably null Het
Iqsec1 C A 6: 90,662,891 R955L probably benign Het
Masp1 A T 16: 23,470,378 H557Q possibly damaging Het
Muc4 C T 16: 32,756,396 T20M Het
Myo16 T C 8: 10,361,095 probably null Het
Nfkb2 T C 19: 46,308,223 F273L possibly damaging Het
Olfr1299 T C 2: 111,664,433 V69A possibly damaging Het
Olfr1489 C T 19: 13,633,569 Q153* probably null Het
Olfr323 A T 11: 58,625,956 I29N probably damaging Het
Olfr355 T C 2: 36,927,209 R302G probably benign Het
Olfr444 T C 6: 42,956,103 C202R possibly damaging Het
Olfr594 T C 7: 103,220,066 V116A possibly damaging Het
Olfr598 A G 7: 103,328,494 S3G probably benign Het
Olfr791 A T 10: 129,527,105 K293* probably null Het
Olfr816 T C 10: 129,912,063 T72A probably damaging Het
Olfr868 A T 9: 20,101,619 M287L probably benign Het
Parp4 T A 14: 56,635,755 I1152N probably damaging Het
Peg3 T C 7: 6,708,168 T1352A probably benign Het
Pik3c2a T C 7: 116,340,096 N1669S probably damaging Het
Pinx1 A T 14: 63,919,206 Q194L probably benign Het
Podxl2 A C 6: 88,849,329 S268A probably benign Het
Polr2c C A 8: 94,870,779 H363N unknown Het
Prlr C T 15: 10,329,023 T528I probably benign Het
Rab37 A C 11: 115,160,661 Q198P probably benign Het
Rrm2b T A 15: 37,937,351 probably null Het
Serpina3b T C 12: 104,130,711 S84P possibly damaging Het
Slc9a3r2 G T 17: 24,641,899 A223D probably damaging Het
Stat4 A T 1: 52,071,709 probably null Het
Them6 T C 15: 74,723,500 I185T probably damaging Het
Tmco4 T A 4: 139,021,699 M316K probably benign Het
Tmtc4 G T 14: 122,978,289 probably null Het
Tnni3k A T 3: 154,962,031 N248K probably benign Het
Trim43a T A 9: 88,583,043 L141Q probably benign Het
Utp20 C T 10: 88,791,745 V953M probably damaging Het
Vmn2r118 T A 17: 55,592,853 T684S probably damaging Het
Wasl A T 6: 24,619,198 I441N unknown Het
Wfikkn2 T C 11: 94,242,359 D64G probably damaging Het
Zfp128 C A 7: 12,890,552 Y282* probably null Het
Other mutations in Agbl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01567:Agbl1 APN 7 76421880 missense probably benign 0.01
IGL01650:Agbl1 APN 7 76420319 missense probably damaging 1.00
IGL02244:Agbl1 APN 7 76766372 missense probably damaging 1.00
IGL03088:Agbl1 APN 7 76720142 missense probably benign 0.12
IGL03143:Agbl1 APN 7 76420045 nonsense probably null
IGL03306:Agbl1 APN 7 76589504 missense probably damaging 1.00
R0001:Agbl1 UTSW 7 76419863 missense probably damaging 0.98
R0045:Agbl1 UTSW 7 76698840 critical splice donor site probably null
R0045:Agbl1 UTSW 7 76698840 critical splice donor site probably null
R0541:Agbl1 UTSW 7 76409245 missense probably benign 0.22
R1889:Agbl1 UTSW 7 76589381 missense probably damaging 1.00
R2089:Agbl1 UTSW 7 76589500 missense probably damaging 0.98
R2091:Agbl1 UTSW 7 76589500 missense probably damaging 0.98
R2091:Agbl1 UTSW 7 76589500 missense probably damaging 0.98
R2127:Agbl1 UTSW 7 76419880 missense possibly damaging 0.64
R2148:Agbl1 UTSW 7 76414717 splice site probably null
R2229:Agbl1 UTSW 7 76433378 missense probably benign 0.43
R2243:Agbl1 UTSW 7 76418722 missense possibly damaging 0.93
R2255:Agbl1 UTSW 7 76422184 missense probably damaging 1.00
R2411:Agbl1 UTSW 7 76720150 missense probably damaging 1.00
R2426:Agbl1 UTSW 7 76421902 missense probably damaging 1.00
R2508:Agbl1 UTSW 7 76589550 critical splice donor site probably null
R2910:Agbl1 UTSW 7 76419838 missense probably benign 0.13
R2919:Agbl1 UTSW 7 76414658 missense probably damaging 1.00
R3056:Agbl1 UTSW 7 76766484 missense possibly damaging 0.60
R3153:Agbl1 UTSW 7 76720196 missense probably damaging 1.00
R3770:Agbl1 UTSW 7 76425929 critical splice donor site probably null
R3825:Agbl1 UTSW 7 76419967 missense probably damaging 0.99
R4632:Agbl1 UTSW 7 76413685 missense probably benign 0.00
R4857:Agbl1 UTSW 7 76419835 missense probably benign 0.03
R4943:Agbl1 UTSW 7 76420016 missense probably benign 0.01
R5055:Agbl1 UTSW 7 76413577 missense probably damaging 1.00
R5071:Agbl1 UTSW 7 76421917 missense probably damaging 1.00
R5072:Agbl1 UTSW 7 76421917 missense probably damaging 1.00
R5074:Agbl1 UTSW 7 76421917 missense probably damaging 1.00
R5095:Agbl1 UTSW 7 76720133 missense probably damaging 0.96
R5133:Agbl1 UTSW 7 76422156 missense probably benign 0.21
R5576:Agbl1 UTSW 7 76335237 missense probably benign 0.03
R5665:Agbl1 UTSW 7 76589503 missense probably damaging 1.00
R5849:Agbl1 UTSW 7 76325098 missense probably benign 0.35
R5924:Agbl1 UTSW 7 76409234 missense probably benign 0.12
R6044:Agbl1 UTSW 7 76318120 missense possibly damaging 0.56
R6117:Agbl1 UTSW 7 76698786 missense probably damaging 1.00
R6144:Agbl1 UTSW 7 76420084 missense probably benign 0.02
R6368:Agbl1 UTSW 7 76419830 missense probably benign 0.25
R6806:Agbl1 UTSW 7 76425921 missense probably damaging 1.00
R7455:Agbl1 UTSW 7 76424755 missense unknown
R7459:Agbl1 UTSW 7 76420066 missense not run
R7485:Agbl1 UTSW 7 76589493 missense unknown
R7516:Agbl1 UTSW 7 76425921 missense probably damaging 1.00
R7561:Agbl1 UTSW 7 76698761 missense unknown
R7630:Agbl1 UTSW 7 76886156 missense unknown
R7655:Agbl1 UTSW 7 76409332 missense
R7656:Agbl1 UTSW 7 76409332 missense
R7658:Agbl1 UTSW 7 76766369 missense unknown
R7681:Agbl1 UTSW 7 76444901 missense unknown
R7694:Agbl1 UTSW 7 76698765 missense unknown
R7773:Agbl1 UTSW 7 76698837 missense unknown
R7981:Agbl1 UTSW 7 76444840 missense unknown
R8208:Agbl1 UTSW 7 76720168 missense unknown
R8317:Agbl1 UTSW 7 76422181 missense unknown
R8406:Agbl1 UTSW 7 76418667 missense
R8432:Agbl1 UTSW 7 77124686 missense unknown
Z1088:Agbl1 UTSW 7 76419904 missense probably benign 0.00
Z1176:Agbl1 UTSW 7 76418685 missense
Z1177:Agbl1 UTSW 7 76720206 missense unknown
Predicted Primers PCR Primer
(F):5'- CAAAATGTGAGCCTTAACTCTTGC -3'
(R):5'- TCAGGGGACTAATGCAAGTTC -3'

Sequencing Primer
(F):5'- CCTCATAAGGGCATCAGTGGTTAC -3'
(R):5'- GCAAACAAACAGGTTGTGG -3'
Posted On2019-10-17