Incidental Mutation 'R7539:Ap5m1'
ID583805
Institutional Source Beutler Lab
Gene Symbol Ap5m1
Ensembl Gene ENSMUSG00000036291
Gene Nameadaptor-related protein complex 5, mu 1 subunit
SynonymsMudeng, 4932432K03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7539 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location49066097-49094234 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 49073557 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 28 (P28Q)
Ref Sequence ENSEMBL: ENSMUSP00000046536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037473] [ENSMUST00000227410] [ENSMUST00000227431] [ENSMUST00000227608] [ENSMUST00000228238]
Predicted Effect probably damaging
Transcript: ENSMUST00000037473
AA Change: P28Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046536
Gene: ENSMUSG00000036291
AA Change: P28Q

DomainStartEndE-ValueType
low complexity region 51 68 N/A INTRINSIC
Pfam:Adap_comp_sub 196 476 3.2e-47 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000227410
AA Change: P28Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000227431
AA Change: P28Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000227608
AA Change: P28Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000227991
Predicted Effect probably damaging
Transcript: ENSMUST00000228238
AA Change: P28Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.4928 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,201,244 I1002V probably benign Het
4930516K23Rik T C 7: 104,059,263 E113G probably damaging Het
Abcf3 T C 16: 20,552,632 probably null Het
Agbl1 T C 7: 76,425,929 probably null Het
Bet1l T C 7: 140,854,544 D83G probably benign Het
Birc6 T C 17: 74,649,696 S3571P probably damaging Het
Bod1l A T 5: 41,817,860 M2037K possibly damaging Het
Ccdc80 A T 16: 45,095,082 E67V probably benign Het
Cep112 A G 11: 108,855,828 M133V probably benign Het
Ckmt2 C A 13: 91,859,944 D224Y probably damaging Het
Crb1 T G 1: 139,248,229 K672T probably damaging Het
Dnhd1 T C 7: 105,720,912 S4515P probably damaging Het
Dock9 A G 14: 121,581,436 S1545P probably damaging Het
Dopey1 T G 9: 86,521,573 S145A probably benign Het
Eps8l1 T C 7: 4,470,037 S92P probably damaging Het
Faap100 T C 11: 120,377,638 D103G possibly damaging Het
Fech T A 18: 64,483,494 probably null Het
Folh1 T A 7: 86,725,909 E623V probably benign Het
Galnt5 T C 2: 58,035,230 L841P probably damaging Het
Ggh C G 4: 20,049,833 S88C probably damaging Het
Gm10577 C T 4: 101,020,696 V1I unknown Het
Grip1 T A 10: 120,054,871 H938Q probably benign Het
Gucy2g G A 19: 55,203,154 A955V probably damaging Het
Hpd G C 5: 123,178,192 Y165* probably null Het
Iqsec1 C A 6: 90,662,891 R955L probably benign Het
Masp1 A T 16: 23,470,378 H557Q possibly damaging Het
Muc4 C T 16: 32,756,396 T20M Het
Myo16 T C 8: 10,361,095 probably null Het
Nfkb2 T C 19: 46,308,223 F273L possibly damaging Het
Olfr1299 T C 2: 111,664,433 V69A possibly damaging Het
Olfr1489 C T 19: 13,633,569 Q153* probably null Het
Olfr323 A T 11: 58,625,956 I29N probably damaging Het
Olfr355 T C 2: 36,927,209 R302G probably benign Het
Olfr444 T C 6: 42,956,103 C202R possibly damaging Het
Olfr594 T C 7: 103,220,066 V116A possibly damaging Het
Olfr598 A G 7: 103,328,494 S3G probably benign Het
Olfr791 A T 10: 129,527,105 K293* probably null Het
Olfr816 T C 10: 129,912,063 T72A probably damaging Het
Olfr868 A T 9: 20,101,619 M287L probably benign Het
Parp4 T A 14: 56,635,755 I1152N probably damaging Het
Peg3 T C 7: 6,708,168 T1352A probably benign Het
Pik3c2a T C 7: 116,340,096 N1669S probably damaging Het
Pinx1 A T 14: 63,919,206 Q194L probably benign Het
Podxl2 A C 6: 88,849,329 S268A probably benign Het
Polr2c C A 8: 94,870,779 H363N unknown Het
Prlr C T 15: 10,329,023 T528I probably benign Het
Rab37 A C 11: 115,160,661 Q198P probably benign Het
Rrm2b T A 15: 37,937,351 probably null Het
Serpina3b T C 12: 104,130,711 S84P possibly damaging Het
Slc9a3r2 G T 17: 24,641,899 A223D probably damaging Het
Stat4 A T 1: 52,071,709 probably null Het
Them6 T C 15: 74,723,500 I185T probably damaging Het
Tmco4 T A 4: 139,021,699 M316K probably benign Het
Tmtc4 G T 14: 122,978,289 probably null Het
Tnni3k A T 3: 154,962,031 N248K probably benign Het
Trim43a T A 9: 88,583,043 L141Q probably benign Het
Utp20 C T 10: 88,791,745 V953M probably damaging Het
Vmn2r118 T A 17: 55,592,853 T684S probably damaging Het
Wasl A T 6: 24,619,198 I441N unknown Het
Wfikkn2 T C 11: 94,242,359 D64G probably damaging Het
Zfp128 C A 7: 12,890,552 Y282* probably null Het
Other mutations in Ap5m1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Ap5m1 APN 14 49073790 missense probably damaging 1.00
IGL01806:Ap5m1 APN 14 49080340 missense probably damaging 1.00
IGL02011:Ap5m1 APN 14 49081135 unclassified probably benign
IGL02165:Ap5m1 APN 14 49078728 missense possibly damaging 0.94
IGL02203:Ap5m1 APN 14 49080258 missense probably damaging 1.00
IGL02950:Ap5m1 APN 14 49073935 missense probably benign 0.44
IGL03123:Ap5m1 APN 14 49073761 missense probably damaging 1.00
IGL03368:Ap5m1 APN 14 49081136 unclassified probably benign
R1688:Ap5m1 UTSW 14 49080834 critical splice acceptor site probably null
R2113:Ap5m1 UTSW 14 49086248 missense probably damaging 1.00
R2184:Ap5m1 UTSW 14 49086295 missense probably damaging 1.00
R2220:Ap5m1 UTSW 14 49081095 missense probably damaging 1.00
R2971:Ap5m1 UTSW 14 49083882 nonsense probably null
R3425:Ap5m1 UTSW 14 49073683 missense probably damaging 0.99
R4506:Ap5m1 UTSW 14 49073761 missense probably damaging 1.00
R4679:Ap5m1 UTSW 14 49078828 missense probably benign 0.00
R4799:Ap5m1 UTSW 14 49081070 missense probably benign 0.08
R6365:Ap5m1 UTSW 14 49078828 missense probably benign 0.00
R6834:Ap5m1 UTSW 14 49073737 missense probably damaging 0.99
R7115:Ap5m1 UTSW 14 49086270 nonsense probably null
R7224:Ap5m1 UTSW 14 49080927 missense unknown
R7383:Ap5m1 UTSW 14 49074196 missense possibly damaging 0.77
R7866:Ap5m1 UTSW 14 49073761 missense probably damaging 1.00
R7897:Ap5m1 UTSW 14 49073775 missense probably benign 0.11
R7949:Ap5m1 UTSW 14 49073761 missense probably damaging 1.00
R7980:Ap5m1 UTSW 14 49073775 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- GGGAGCAGGTTTAATGGCTC -3'
(R):5'- TCCCTCAGGAAGGCAATGAC -3'

Sequencing Primer
(F):5'- AGGTTTAATGGCTCAGGGTTATTTTC -3'
(R):5'- AATGACTGGCCAGAGCTCTTC -3'
Posted On2019-10-17