Incidental Mutation 'R7539:Cplane1'
ID 583809
Institutional Source Beutler Lab
Gene Symbol Cplane1
Ensembl Gene ENSMUSG00000039801
Gene Name ciliogenesis and planar polarity effector 1
Synonyms Hug, 2410089E03Rik, b2b012Clo, Jbts17
MMRRC Submission 045611-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7539 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 8198590-8300642 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 8230728 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 1002 (I1002V)
Ref Sequence ENSEMBL: ENSMUSP00000106247 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110617]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000110617
AA Change: I1002V

PolyPhen 2 Score 0.190 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000106247
Gene: ENSMUSG00000039801
AA Change: I1002V

DomainStartEndE-ValueType
low complexity region 144 157 N/A INTRINSIC
low complexity region 338 352 N/A INTRINSIC
low complexity region 466 476 N/A INTRINSIC
low complexity region 868 883 N/A INTRINSIC
low complexity region 949 962 N/A INTRINSIC
low complexity region 1400 1415 N/A INTRINSIC
low complexity region 1449 1464 N/A INTRINSIC
low complexity region 1827 1838 N/A INTRINSIC
low complexity region 1919 1930 N/A INTRINSIC
low complexity region 2130 2145 N/A INTRINSIC
coiled coil region 2750 2782 N/A INTRINSIC
low complexity region 2838 2850 N/A INTRINSIC
Pfam:Joubert 2894 3207 1.9e-136 PFAM
Meta Mutation Damage Score 0.0619 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. Defects in this gene are a cause of Joubert syndrome (JBTS). [provided by RefSeq, May 2012]
PHENOTYPE: Homozygotes exhibit double outlet right ventricle {SDD}, pulmonary atresia/hypolastic pulmonary artery, atrioventricular septal defect, and right aortic arch. Non-cardiovascular defects include cleft palate, polydactyly, transparent chest wall (sternal bone hypoplasia) and hypoplastic lungs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930516K23Rik T C 7: 103,708,470 (GRCm39) E113G probably damaging Het
Abcf3 T C 16: 20,371,382 (GRCm39) probably null Het
Agbl1 T C 7: 76,075,677 (GRCm39) probably null Het
Ap5m1 C A 14: 49,311,014 (GRCm39) P28Q probably damaging Het
Bet1l T C 7: 140,434,457 (GRCm39) D83G probably benign Het
Birc6 T C 17: 74,956,691 (GRCm39) S3571P probably damaging Het
Bod1l A T 5: 41,975,203 (GRCm39) M2037K possibly damaging Het
Ccdc80 A T 16: 44,915,445 (GRCm39) E67V probably benign Het
Cep112 A G 11: 108,746,654 (GRCm39) M133V probably benign Het
Ckmt2 C A 13: 92,008,063 (GRCm39) D224Y probably damaging Het
Crb1 T G 1: 139,175,967 (GRCm39) K672T probably damaging Het
Dnhd1 T C 7: 105,370,119 (GRCm39) S4515P probably damaging Het
Dock9 A G 14: 121,818,848 (GRCm39) S1545P probably damaging Het
Dop1a T G 9: 86,403,626 (GRCm39) S145A probably benign Het
Eps8l1 T C 7: 4,473,036 (GRCm39) S92P probably damaging Het
Faap100 T C 11: 120,268,464 (GRCm39) D103G possibly damaging Het
Fech T A 18: 64,616,565 (GRCm39) probably null Het
Folh1 T A 7: 86,375,117 (GRCm39) E623V probably benign Het
Galnt5 T C 2: 57,925,242 (GRCm39) L841P probably damaging Het
Ggh C G 4: 20,049,833 (GRCm39) S88C probably damaging Het
Gm10577 C T 4: 100,877,893 (GRCm39) V1I unknown Het
Grip1 T A 10: 119,890,776 (GRCm39) H938Q probably benign Het
Gucy2g G A 19: 55,191,586 (GRCm39) A955V probably damaging Het
Hpd G C 5: 123,316,255 (GRCm39) Y165* probably null Het
Iqsec1 C A 6: 90,639,873 (GRCm39) R955L probably benign Het
Masp1 A T 16: 23,289,128 (GRCm39) H557Q possibly damaging Het
Muc4 C T 16: 32,576,770 (GRCm39) T20M Het
Myo16 T C 8: 10,411,095 (GRCm39) probably null Het
Nfkb2 T C 19: 46,296,662 (GRCm39) F273L possibly damaging Het
Nherf2 G T 17: 24,860,873 (GRCm39) A223D probably damaging Het
Or11l3 A T 11: 58,516,782 (GRCm39) I29N probably damaging Het
Or1l8 T C 2: 36,817,221 (GRCm39) R302G probably benign Het
Or2a56 T C 6: 42,933,037 (GRCm39) C202R possibly damaging Het
Or4k49 T C 2: 111,494,778 (GRCm39) V69A possibly damaging Het
Or52ab7 A G 7: 102,977,701 (GRCm39) S3G probably benign Het
Or52e3 T C 7: 102,869,273 (GRCm39) V116A possibly damaging Het
Or5b124 C T 19: 13,610,933 (GRCm39) Q153* probably null Het
Or6c2 A T 10: 129,362,974 (GRCm39) K293* probably null Het
Or6c69 T C 10: 129,747,932 (GRCm39) T72A probably damaging Het
Or7e174 A T 9: 20,012,915 (GRCm39) M287L probably benign Het
Parp4 T A 14: 56,873,212 (GRCm39) I1152N probably damaging Het
Peg3 T C 7: 6,711,167 (GRCm39) T1352A probably benign Het
Pik3c2a T C 7: 115,939,331 (GRCm39) N1669S probably damaging Het
Pinx1 A T 14: 64,156,655 (GRCm39) Q194L probably benign Het
Podxl2 A C 6: 88,826,311 (GRCm39) S268A probably benign Het
Polr2c C A 8: 95,597,407 (GRCm39) H363N unknown Het
Prlr C T 15: 10,329,109 (GRCm39) T528I probably benign Het
Rab37 A C 11: 115,051,487 (GRCm39) Q198P probably benign Het
Rrm2b T A 15: 37,937,595 (GRCm39) probably null Het
Serpina3b T C 12: 104,096,970 (GRCm39) S84P possibly damaging Het
Stat4 A T 1: 52,110,868 (GRCm39) probably null Het
Them6 T C 15: 74,595,349 (GRCm39) I185T probably damaging Het
Tmco4 T A 4: 138,749,010 (GRCm39) M316K probably benign Het
Tmtc4 G T 14: 123,215,701 (GRCm39) probably null Het
Tnni3k A T 3: 154,667,668 (GRCm39) N248K probably benign Het
Trim43a T A 9: 88,465,096 (GRCm39) L141Q probably benign Het
Utp20 C T 10: 88,627,607 (GRCm39) V953M probably damaging Het
Vmn2r118 T A 17: 55,899,853 (GRCm39) T684S probably damaging Het
Wasl A T 6: 24,619,197 (GRCm39) I441N unknown Het
Wfikkn2 T C 11: 94,133,185 (GRCm39) D64G probably damaging Het
Zfp128 C A 7: 12,624,479 (GRCm39) Y282* probably null Het
Other mutations in Cplane1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00756:Cplane1 APN 15 8,293,931 (GRCm39) splice site probably benign
IGL00766:Cplane1 APN 15 8,281,648 (GRCm39) missense unknown
IGL01483:Cplane1 APN 15 8,216,591 (GRCm39) missense probably damaging 0.98
IGL01520:Cplane1 APN 15 8,251,395 (GRCm39) missense probably damaging 0.96
IGL01578:Cplane1 APN 15 8,300,194 (GRCm39) missense unknown
IGL01701:Cplane1 APN 15 8,232,741 (GRCm39) splice site probably benign
IGL01892:Cplane1 APN 15 8,271,749 (GRCm39) splice site probably benign
IGL01895:Cplane1 APN 15 8,258,591 (GRCm39) missense possibly damaging 0.63
IGL01922:Cplane1 APN 15 8,300,305 (GRCm39) missense unknown
IGL01978:Cplane1 APN 15 8,248,866 (GRCm39) missense probably damaging 0.98
IGL02031:Cplane1 APN 15 8,209,253 (GRCm39) missense probably damaging 0.99
IGL02318:Cplane1 APN 15 8,204,509 (GRCm39) missense probably damaging 0.98
IGL02321:Cplane1 APN 15 8,246,056 (GRCm39) missense probably benign 0.04
IGL02363:Cplane1 APN 15 8,247,921 (GRCm39) missense possibly damaging 0.68
IGL02404:Cplane1 APN 15 8,216,768 (GRCm39) missense possibly damaging 0.48
IGL02535:Cplane1 APN 15 8,204,322 (GRCm39) missense probably damaging 1.00
IGL02732:Cplane1 APN 15 8,209,375 (GRCm39) missense probably benign 0.03
IGL02895:Cplane1 APN 15 8,261,591 (GRCm39) splice site probably benign
IGL02903:Cplane1 APN 15 8,299,262 (GRCm39) missense unknown
IGL02903:Cplane1 APN 15 8,299,263 (GRCm39) missense unknown
IGL02979:Cplane1 APN 15 8,248,038 (GRCm39) missense possibly damaging 0.82
IGL03077:Cplane1 APN 15 8,242,279 (GRCm39) splice site probably benign
IGL03196:Cplane1 APN 15 8,230,826 (GRCm39) missense probably damaging 0.98
IGL03344:Cplane1 APN 15 8,216,942 (GRCm39) missense possibly damaging 0.63
IGL03368:Cplane1 APN 15 8,251,857 (GRCm39) missense probably benign 0.06
IGL03403:Cplane1 APN 15 8,230,826 (GRCm39) missense probably damaging 0.98
agnes UTSW 15 8,276,422 (GRCm39) nonsense probably null
dei UTSW 15 8,215,649 (GRCm39) missense probably damaging 1.00
R0015:Cplane1 UTSW 15 8,215,668 (GRCm39) missense probably damaging 1.00
R0015:Cplane1 UTSW 15 8,215,668 (GRCm39) missense probably damaging 1.00
R0101:Cplane1 UTSW 15 8,250,444 (GRCm39) missense probably benign 0.00
R0105:Cplane1 UTSW 15 8,216,876 (GRCm39) missense probably benign
R0105:Cplane1 UTSW 15 8,216,876 (GRCm39) missense probably benign
R0165:Cplane1 UTSW 15 8,245,866 (GRCm39) missense probably damaging 1.00
R0306:Cplane1 UTSW 15 8,209,373 (GRCm39) missense probably damaging 1.00
R0433:Cplane1 UTSW 15 8,246,046 (GRCm39) missense probably benign 0.00
R0491:Cplane1 UTSW 15 8,211,727 (GRCm39) missense probably damaging 1.00
R0523:Cplane1 UTSW 15 8,223,870 (GRCm39) missense probably damaging 1.00
R0571:Cplane1 UTSW 15 8,289,277 (GRCm39) missense unknown
R0679:Cplane1 UTSW 15 8,252,606 (GRCm39) missense probably benign 0.39
R0704:Cplane1 UTSW 15 8,239,567 (GRCm39) missense possibly damaging 0.93
R0707:Cplane1 UTSW 15 8,287,805 (GRCm39) missense unknown
R0715:Cplane1 UTSW 15 8,252,576 (GRCm39) missense probably benign 0.14
R0762:Cplane1 UTSW 15 8,247,900 (GRCm39) unclassified probably benign
R0830:Cplane1 UTSW 15 8,276,669 (GRCm39) missense unknown
R0924:Cplane1 UTSW 15 8,280,554 (GRCm39) splice site probably benign
R1071:Cplane1 UTSW 15 8,247,910 (GRCm39) missense probably benign 0.20
R1184:Cplane1 UTSW 15 8,245,971 (GRCm39) missense probably benign
R1224:Cplane1 UTSW 15 8,207,869 (GRCm39) missense probably benign 0.06
R1416:Cplane1 UTSW 15 8,276,422 (GRCm39) nonsense probably null
R1428:Cplane1 UTSW 15 8,248,853 (GRCm39) missense possibly damaging 0.83
R1487:Cplane1 UTSW 15 8,215,715 (GRCm39) missense probably damaging 1.00
R1641:Cplane1 UTSW 15 8,258,443 (GRCm39) missense probably benign 0.41
R1652:Cplane1 UTSW 15 8,230,630 (GRCm39) missense probably damaging 1.00
R1688:Cplane1 UTSW 15 8,258,093 (GRCm39) missense probably benign 0.00
R1715:Cplane1 UTSW 15 8,256,384 (GRCm39) splice site probably null
R1820:Cplane1 UTSW 15 8,299,129 (GRCm39) missense unknown
R1863:Cplane1 UTSW 15 8,258,077 (GRCm39) missense probably benign 0.00
R1940:Cplane1 UTSW 15 8,263,336 (GRCm39) missense probably damaging 0.98
R1967:Cplane1 UTSW 15 8,232,904 (GRCm39) missense probably benign 0.09
R2064:Cplane1 UTSW 15 8,215,649 (GRCm39) missense probably damaging 1.00
R2076:Cplane1 UTSW 15 8,248,741 (GRCm39) missense possibly damaging 0.93
R2163:Cplane1 UTSW 15 8,232,735 (GRCm39) splice site probably null
R2208:Cplane1 UTSW 15 8,223,887 (GRCm39) missense probably benign 0.33
R2504:Cplane1 UTSW 15 8,248,700 (GRCm39) missense probably damaging 0.99
R2568:Cplane1 UTSW 15 8,230,753 (GRCm39) missense possibly damaging 0.70
R2845:Cplane1 UTSW 15 8,245,864 (GRCm39) missense probably damaging 1.00
R2913:Cplane1 UTSW 15 8,300,169 (GRCm39) missense unknown
R3056:Cplane1 UTSW 15 8,280,491 (GRCm39) missense unknown
R3706:Cplane1 UTSW 15 8,289,300 (GRCm39) missense unknown
R3707:Cplane1 UTSW 15 8,289,300 (GRCm39) missense unknown
R3870:Cplane1 UTSW 15 8,247,948 (GRCm39) missense probably damaging 0.98
R3877:Cplane1 UTSW 15 8,251,427 (GRCm39) missense probably benign
R3886:Cplane1 UTSW 15 8,201,289 (GRCm39) missense probably damaging 0.98
R4057:Cplane1 UTSW 15 8,248,509 (GRCm39) missense probably benign 0.08
R4090:Cplane1 UTSW 15 8,241,842 (GRCm39) splice site probably null
R4362:Cplane1 UTSW 15 8,300,229 (GRCm39) missense unknown
R4363:Cplane1 UTSW 15 8,300,229 (GRCm39) missense unknown
R4445:Cplane1 UTSW 15 8,281,672 (GRCm39) missense unknown
R4581:Cplane1 UTSW 15 8,201,282 (GRCm39) missense possibly damaging 0.85
R4587:Cplane1 UTSW 15 8,230,636 (GRCm39) missense possibly damaging 0.50
R4659:Cplane1 UTSW 15 8,245,760 (GRCm39) intron probably benign
R4663:Cplane1 UTSW 15 8,247,939 (GRCm39) missense probably benign 0.31
R4779:Cplane1 UTSW 15 8,248,322 (GRCm39) missense probably benign 0.04
R4812:Cplane1 UTSW 15 8,230,607 (GRCm39) splice site probably null
R4850:Cplane1 UTSW 15 8,292,422 (GRCm39) missense unknown
R4896:Cplane1 UTSW 15 8,251,421 (GRCm39) missense probably benign 0.00
R5273:Cplane1 UTSW 15 8,292,422 (GRCm39) missense unknown
R5273:Cplane1 UTSW 15 8,273,825 (GRCm39) missense probably damaging 0.98
R5303:Cplane1 UTSW 15 8,290,174 (GRCm39) splice site probably null
R5307:Cplane1 UTSW 15 8,290,174 (GRCm39) splice site probably null
R5308:Cplane1 UTSW 15 8,290,174 (GRCm39) splice site probably null
R5373:Cplane1 UTSW 15 8,300,287 (GRCm39) missense unknown
R5374:Cplane1 UTSW 15 8,300,287 (GRCm39) missense unknown
R5386:Cplane1 UTSW 15 8,223,897 (GRCm39) missense probably damaging 1.00
R5534:Cplane1 UTSW 15 8,258,319 (GRCm39) missense probably benign 0.06
R5720:Cplane1 UTSW 15 8,233,171 (GRCm39) missense probably benign 0.35
R5891:Cplane1 UTSW 15 8,218,073 (GRCm39) missense probably benign 0.00
R5932:Cplane1 UTSW 15 8,274,079 (GRCm39) splice site probably null
R6053:Cplane1 UTSW 15 8,217,945 (GRCm39) missense probably benign 0.35
R6166:Cplane1 UTSW 15 8,216,044 (GRCm39) missense probably benign 0.00
R6245:Cplane1 UTSW 15 8,207,902 (GRCm39) missense probably benign 0.01
R6246:Cplane1 UTSW 15 8,239,498 (GRCm39) missense probably damaging 1.00
R6541:Cplane1 UTSW 15 8,248,779 (GRCm39) missense possibly damaging 0.48
R6622:Cplane1 UTSW 15 8,273,706 (GRCm39) missense probably damaging 0.98
R6707:Cplane1 UTSW 15 8,252,606 (GRCm39) missense probably benign 0.39
R6729:Cplane1 UTSW 15 8,218,085 (GRCm39) splice site probably null
R6805:Cplane1 UTSW 15 8,273,790 (GRCm39) missense probably benign 0.07
R6806:Cplane1 UTSW 15 8,216,342 (GRCm39) missense possibly damaging 0.55
R6813:Cplane1 UTSW 15 8,258,766 (GRCm39) missense probably benign
R6830:Cplane1 UTSW 15 8,205,668 (GRCm39) missense probably benign 0.04
R6845:Cplane1 UTSW 15 8,251,388 (GRCm39) missense possibly damaging 0.84
R6894:Cplane1 UTSW 15 8,216,852 (GRCm39) missense probably damaging 0.99
R6970:Cplane1 UTSW 15 8,217,032 (GRCm39) missense probably benign 0.01
R6991:Cplane1 UTSW 15 8,281,690 (GRCm39) missense unknown
R7003:Cplane1 UTSW 15 8,258,246 (GRCm39) missense probably damaging 0.99
R7088:Cplane1 UTSW 15 8,248,431 (GRCm39) missense probably benign 0.16
R7104:Cplane1 UTSW 15 8,223,928 (GRCm39) missense possibly damaging 0.83
R7311:Cplane1 UTSW 15 8,210,399 (GRCm39) missense probably damaging 1.00
R7374:Cplane1 UTSW 15 8,276,731 (GRCm39) missense unknown
R7446:Cplane1 UTSW 15 8,261,564 (GRCm39) missense probably damaging 0.98
R7543:Cplane1 UTSW 15 8,254,876 (GRCm39) missense unknown
R7558:Cplane1 UTSW 15 8,254,851 (GRCm39) missense unknown
R7629:Cplane1 UTSW 15 8,256,551 (GRCm39) nonsense probably null
R7635:Cplane1 UTSW 15 8,256,404 (GRCm39) missense probably benign 0.01
R7644:Cplane1 UTSW 15 8,252,611 (GRCm39) missense probably benign 0.00
R7705:Cplane1 UTSW 15 8,211,736 (GRCm39) missense probably damaging 1.00
R7752:Cplane1 UTSW 15 8,299,190 (GRCm39) missense unknown
R7754:Cplane1 UTSW 15 8,273,310 (GRCm39) missense possibly damaging 0.53
R7757:Cplane1 UTSW 15 8,281,711 (GRCm39) missense unknown
R7836:Cplane1 UTSW 15 8,233,241 (GRCm39) missense probably damaging 0.97
R7875:Cplane1 UTSW 15 8,239,446 (GRCm39) missense probably benign 0.18
R7901:Cplane1 UTSW 15 8,299,190 (GRCm39) missense unknown
R7983:Cplane1 UTSW 15 8,251,299 (GRCm39) missense probably benign 0.01
R8030:Cplane1 UTSW 15 8,259,787 (GRCm39) missense probably damaging 1.00
R8088:Cplane1 UTSW 15 8,215,802 (GRCm39) missense probably benign 0.00
R8231:Cplane1 UTSW 15 8,248,511 (GRCm39) missense probably benign 0.16
R8443:Cplane1 UTSW 15 8,230,635 (GRCm39) missense probably benign 0.03
R8480:Cplane1 UTSW 15 8,216,942 (GRCm39) missense possibly damaging 0.63
R8693:Cplane1 UTSW 15 8,258,492 (GRCm39) missense probably benign 0.15
R8785:Cplane1 UTSW 15 8,204,244 (GRCm39) missense probably benign 0.39
R8791:Cplane1 UTSW 15 8,216,744 (GRCm39) missense probably damaging 1.00
R8822:Cplane1 UTSW 15 8,201,262 (GRCm39) missense probably damaging 1.00
R8831:Cplane1 UTSW 15 8,211,620 (GRCm39) missense probably benign 0.09
R8932:Cplane1 UTSW 15 8,223,859 (GRCm39) missense probably damaging 1.00
R8968:Cplane1 UTSW 15 8,230,765 (GRCm39) missense possibly damaging 0.84
R8973:Cplane1 UTSW 15 8,233,277 (GRCm39) missense probably damaging 1.00
R9036:Cplane1 UTSW 15 8,252,622 (GRCm39) missense possibly damaging 0.63
R9134:Cplane1 UTSW 15 8,228,716 (GRCm39) missense probably damaging 0.99
R9197:Cplane1 UTSW 15 8,280,536 (GRCm39) missense unknown
R9259:Cplane1 UTSW 15 8,232,787 (GRCm39) missense possibly damaging 0.82
R9269:Cplane1 UTSW 15 8,248,500 (GRCm39) missense probably damaging 0.97
R9294:Cplane1 UTSW 15 8,232,811 (GRCm39) missense probably benign 0.00
R9328:Cplane1 UTSW 15 8,215,692 (GRCm39) missense probably damaging 1.00
R9563:Cplane1 UTSW 15 8,216,563 (GRCm39) missense probably benign 0.20
R9680:Cplane1 UTSW 15 8,231,785 (GRCm39) missense possibly damaging 0.68
R9721:Cplane1 UTSW 15 8,254,893 (GRCm39) missense unknown
R9779:Cplane1 UTSW 15 8,230,786 (GRCm39) missense possibly damaging 0.93
R9780:Cplane1 UTSW 15 8,258,123 (GRCm39) missense probably benign 0.00
U24488:Cplane1 UTSW 15 8,211,694 (GRCm39) missense probably damaging 1.00
X0023:Cplane1 UTSW 15 8,276,515 (GRCm39) missense unknown
Z1177:Cplane1 UTSW 15 8,239,473 (GRCm39) missense probably damaging 0.98
Z1177:Cplane1 UTSW 15 8,204,456 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATATTTCAGGAGTTTGGATCTATG -3'
(R):5'- GAATGTTTCTGGCCTTACCCTCA -3'

Sequencing Primer
(F):5'- TCAGGAGTTTGGATCTATGTATGC -3'
(R):5'- AGTCAGTGCTCTTAACCGCTGAG -3'
Posted On 2019-10-17