Incidental Mutation 'R7540:Tmco1'
ID583825
Institutional Source Beutler Lab
Gene Symbol Tmco1
Ensembl Gene ENSMUSG00000052428
Gene Nametransmembrane and coiled-coil domains 1
SynonymsESTM39, 4930403O06Rik, 1190006A08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.439) question?
Stock #R7540 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location167308378-167333978 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 167326003 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 162 (T162A)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097473] [ENSMUST00000195015]
Predicted Effect probably benign
Transcript: ENSMUST00000097473
AA Change: T151A

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000095081
Gene: ENSMUSG00000052428
AA Change: T151A

DomainStartEndE-ValueType
Pfam:DUF106 3 166 6.4e-47 PFAM
Predicted Effect silent
Transcript: ENSMUST00000193101
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000195015
AA Change: T151A

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000142042
Gene: ENSMUSG00000052428
AA Change: T151A

DomainStartEndE-ValueType
Pfam:DUF106 3 166 2.7e-51 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a transmembrane protein. Mutations at this locus have been associated with craniofacial dysmorphism, skeletal anomalies, and mental retardation. Mutations at this locus have also been associated with open angle glaucoma blindness. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial prenatal lethality, postnatal growth retardation, delayed osteogenesis, craniofacial anomalies, enlarged brain ventricles, impaired coordination and spatial recognition memory, abnormal calcium ion homeostasis, and decreased survivor rate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930516K23Rik T C 7: 104,059,263 E113G probably damaging Het
Adamts8 A G 9: 30,959,064 E650G probably damaging Het
Adgrg7 G A 16: 56,750,429 T412M probably damaging Het
Ank2 C T 3: 126,988,159 V7I possibly damaging Het
Bpifb1 G A 2: 154,213,111 V308M probably damaging Het
C3 A G 17: 57,206,220 S1476P probably benign Het
Dgkb A T 12: 37,981,790 probably benign Het
Fmn1 A G 2: 113,529,310 probably null Het
Foxb1 G A 9: 69,759,859 Q130* probably null Het
Gemin5 C T 11: 58,130,402 probably null Het
Ghr T A 15: 3,319,914 D594V possibly damaging Het
Gm10272 A C 10: 77,706,626 M1L unknown Het
Gm11239 C T 4: 73,668,411 probably benign Het
Gpr161 G A 1: 165,318,835 V447M probably damaging Het
Hspg2 T A 4: 137,541,440 S2157T possibly damaging Het
Irs1 A G 1: 82,288,002 V831A not run Het
Itga8 T A 2: 12,111,037 I1014L possibly damaging Het
Iws1 T A 18: 32,080,483 S321R possibly damaging Het
Kctd19 G T 8: 105,386,935 P702Q probably benign Het
Man2c1 G A 9: 57,140,275 D739N probably damaging Het
Mboat4 T A 8: 34,124,024 L205Q probably damaging Het
Meis3 C A 7: 16,177,493 Y38* probably null Het
Mroh7 G T 4: 106,720,398 T361K possibly damaging Het
Myl6b T A 10: 128,496,280 K106* probably null Het
Naaa T A 5: 92,263,724 T241S probably benign Het
Neurog3 T G 10: 62,133,977 I172S probably benign Het
Nub1 T G 5: 24,701,529 I351R probably damaging Het
Olfr328 C A 11: 58,551,631 V203L possibly damaging Het
Olfr402 A T 11: 74,155,588 R145W probably benign Het
Olfr777 A T 10: 129,269,134 F63Y probably benign Het
Osbp2 T C 11: 3,717,944 K18E probably damaging Het
Pcdh8 A T 14: 79,771,103 W7R probably benign Het
Pcsk7 G T 9: 45,927,673 probably null Het
Plin4 G A 17: 56,104,883 T716I probably damaging Het
Prkcb G A 7: 122,568,134 V356I probably damaging Het
Pus7 G A 5: 23,760,246 T304I probably damaging Het
Rmnd1 A G 10: 4,403,989 V402A probably damaging Het
Slmap T C 14: 26,460,191 E329G probably damaging Het
Sytl3 T C 17: 6,681,947 probably benign Het
Tg A G 15: 66,689,927 I1087V probably benign Het
Tti1 G A 2: 158,007,996 T441I probably benign Het
Tubgcp6 G T 15: 89,102,323 Q1366K possibly damaging Het
Ush1g T C 11: 115,318,573 K265R probably benign Het
Zdhhc8 A G 16: 18,227,810 V209A probably damaging Het
Zfp160 T A 17: 21,025,660 Y157* probably null Het
Zfp423 A T 8: 87,688,067 C1208S possibly damaging Het
Zfyve26 A T 12: 79,268,676 V1342E probably damaging Het
Zmym1 A T 4: 127,048,757 C613S probably benign Het
Other mutations in Tmco1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00740:Tmco1 APN 1 167316268 missense probably damaging 1.00
IGL02619:Tmco1 APN 1 167326028 splice site probably benign
IGL03093:Tmco1 APN 1 167316279 missense probably damaging 1.00
R0317:Tmco1 UTSW 1 167325893 missense probably damaging 0.96
R1704:Tmco1 UTSW 1 167325937 missense possibly damaging 0.64
R7144:Tmco1 UTSW 1 167308453 start gained probably benign
R7851:Tmco1 UTSW 1 167308686 start gained probably benign
R7934:Tmco1 UTSW 1 167308686 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TGTCCTACCTGTACCCAGAC -3'
(R):5'- TGCAGGCATGTAACACAGCTG -3'

Sequencing Primer
(F):5'- ACCTGTACCCAGACTTCTTCCTG -3'
(R):5'- TTACAGAGGCAGAGCTAG -3'
Posted On2019-10-17