Incidental Mutation 'R7540:Meis3'
ID583837
Institutional Source Beutler Lab
Gene Symbol Meis3
Ensembl Gene ENSMUSG00000041420
Gene NameMeis homeobox 3
SynonymsMrg2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.196) question?
Stock #R7540 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location16175090-16186504 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 16177493 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 38 (Y38*)
Ref Sequence ENSEMBL: ENSMUSP00000002495 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002495] [ENSMUST00000176342] [ENSMUST00000176446] [ENSMUST00000176506] [ENSMUST00000177156] [ENSMUST00000177540]
Predicted Effect probably null
Transcript: ENSMUST00000002495
AA Change: Y38*
SMART Domains Protein: ENSMUSP00000002495
Gene: ENSMUSG00000041420
AA Change: Y38*

DomainStartEndE-ValueType
low complexity region 88 101 N/A INTRINSIC
low complexity region 230 244 N/A INTRINSIC
HOX 265 330 9.15e-12 SMART
Predicted Effect probably null
Transcript: ENSMUST00000176342
AA Change: Y38*
SMART Domains Protein: ENSMUSP00000135302
Gene: ENSMUSG00000041420
AA Change: Y38*

DomainStartEndE-ValueType
low complexity region 88 101 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176446
Predicted Effect probably null
Transcript: ENSMUST00000176506
AA Change: Y38*
SMART Domains Protein: ENSMUSP00000134918
Gene: ENSMUSG00000041420
AA Change: Y38*

DomainStartEndE-ValueType
low complexity region 88 101 N/A INTRINSIC
low complexity region 213 227 N/A INTRINSIC
HOX 248 313 9.15e-12 SMART
Predicted Effect probably null
Transcript: ENSMUST00000177156
AA Change: Y38*
SMART Domains Protein: ENSMUSP00000135103
Gene: ENSMUSG00000041420
AA Change: Y38*

DomainStartEndE-ValueType
low complexity region 88 101 N/A INTRINSIC
low complexity region 230 244 N/A INTRINSIC
Pfam:Homeobox_KN 283 313 2e-12 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000177540
AA Change: Y38*
SMART Domains Protein: ENSMUSP00000135388
Gene: ENSMUSG00000041420
AA Change: Y38*

DomainStartEndE-ValueType
low complexity region 88 101 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: The protein encoding this gene belongs to the three amino acid loop extension family of homeodomain transcription factors, which play essential roles in many embryonic processes. These proteins are characterized by an atypical homeodomain containing a three amino acid loop extension between helices 1 and 2. Expression of this gene begins during the compaction stage of embryogenesis and continues into the blastocyst stage. This gene is also expressed in pancreatic islet cells and beta-cells and regulates beta-cell survival. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930516K23Rik T C 7: 104,059,263 E113G probably damaging Het
Adamts8 A G 9: 30,959,064 E650G probably damaging Het
Adgrg7 G A 16: 56,750,429 T412M probably damaging Het
Ank2 C T 3: 126,988,159 V7I possibly damaging Het
Bpifb1 G A 2: 154,213,111 V308M probably damaging Het
C3 A G 17: 57,206,220 S1476P probably benign Het
Dgkb A T 12: 37,981,790 probably benign Het
Fmn1 A G 2: 113,529,310 probably null Het
Foxb1 G A 9: 69,759,859 Q130* probably null Het
Gemin5 C T 11: 58,130,402 probably null Het
Ghr T A 15: 3,319,914 D594V possibly damaging Het
Gm10272 A C 10: 77,706,626 M1L unknown Het
Gm11239 C T 4: 73,668,411 probably benign Het
Gpr161 G A 1: 165,318,835 V447M probably damaging Het
Hspg2 T A 4: 137,541,440 S2157T possibly damaging Het
Irs1 A G 1: 82,288,002 V831A not run Het
Itga8 T A 2: 12,111,037 I1014L possibly damaging Het
Iws1 T A 18: 32,080,483 S321R possibly damaging Het
Kctd19 G T 8: 105,386,935 P702Q probably benign Het
Man2c1 G A 9: 57,140,275 D739N probably damaging Het
Mboat4 T A 8: 34,124,024 L205Q probably damaging Het
Mroh7 G T 4: 106,720,398 T361K possibly damaging Het
Myl6b T A 10: 128,496,280 K106* probably null Het
Naaa T A 5: 92,263,724 T241S probably benign Het
Neurog3 T G 10: 62,133,977 I172S probably benign Het
Nub1 T G 5: 24,701,529 I351R probably damaging Het
Olfr328 C A 11: 58,551,631 V203L possibly damaging Het
Olfr402 A T 11: 74,155,588 R145W probably benign Het
Olfr777 A T 10: 129,269,134 F63Y probably benign Het
Osbp2 T C 11: 3,717,944 K18E probably damaging Het
Pcdh8 A T 14: 79,771,103 W7R probably benign Het
Pcsk7 G T 9: 45,927,673 probably null Het
Plin4 G A 17: 56,104,883 T716I probably damaging Het
Prkcb G A 7: 122,568,134 V356I probably damaging Het
Pus7 G A 5: 23,760,246 T304I probably damaging Het
Rmnd1 A G 10: 4,403,989 V402A probably damaging Het
Slmap T C 14: 26,460,191 E329G probably damaging Het
Sytl3 T C 17: 6,681,947 probably benign Het
Tg A G 15: 66,689,927 I1087V probably benign Het
Tmco1 A G 1: 167,326,003 T162A Het
Tti1 G A 2: 158,007,996 T441I probably benign Het
Tubgcp6 G T 15: 89,102,323 Q1366K possibly damaging Het
Ush1g T C 11: 115,318,573 K265R probably benign Het
Zdhhc8 A G 16: 18,227,810 V209A probably damaging Het
Zfp160 T A 17: 21,025,660 Y157* probably null Het
Zfp423 A T 8: 87,688,067 C1208S possibly damaging Het
Zfyve26 A T 12: 79,268,676 V1342E probably damaging Het
Zmym1 A T 4: 127,048,757 C613S probably benign Het
Other mutations in Meis3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Meis3 APN 7 16178947 critical splice acceptor site probably benign 0.00
IGL02508:Meis3 APN 7 16178797 unclassified probably null
IGL03125:Meis3 APN 7 16178770 missense probably damaging 1.00
IGL03383:Meis3 APN 7 16183819 missense probably damaging 1.00
R0032:Meis3 UTSW 7 16182285 unclassified probably benign
R1147:Meis3 UTSW 7 16183776 unclassified probably benign
R1471:Meis3 UTSW 7 16177571 nonsense probably null
R3054:Meis3 UTSW 7 16182453 missense probably damaging 1.00
R3927:Meis3 UTSW 7 16177494 missense probably benign 0.06
R5314:Meis3 UTSW 7 16184064 missense probably damaging 0.99
R6713:Meis3 UTSW 7 16182330 nonsense probably null
R6847:Meis3 UTSW 7 16183864 missense probably damaging 1.00
R7218:Meis3 UTSW 7 16184701 missense probably benign
R7517:Meis3 UTSW 7 16177818 missense probably damaging 1.00
R7699:Meis3 UTSW 7 16177556 missense probably benign
R7700:Meis3 UTSW 7 16177556 missense probably benign
R7790:Meis3 UTSW 7 16182397 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- GGCTGGGATCCTTGAATACTG -3'
(R):5'- CAGGAAAGTGGGCATTCGTG -3'

Sequencing Primer
(F):5'- GCTGGGATCCTTGAATACTGAAGTAC -3'
(R):5'- TGGGCATTCGTGAGGGGAAATAG -3'
Posted On2019-10-17