Incidental Mutation 'R7540:Neurog3'
ID583848
Institutional Source Beutler Lab
Gene Symbol Neurog3
Ensembl Gene ENSMUSG00000044312
Gene Nameneurogenin 3
SynonymsAtoh5, Math4B, bHLHa7, ngn3
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7540 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location62133090-62134763 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 62133977 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 172 (I172S)
Ref Sequence ENSEMBL: ENSMUSP00000054054 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027719] [ENSMUST00000050103] [ENSMUST00000141724] [ENSMUST00000150057] [ENSMUST00000156798] [ENSMUST00000218121]
Predicted Effect probably benign
Transcript: ENSMUST00000027719
SMART Domains Protein: ENSMUSP00000027719
Gene: ENSMUSG00000020083

DomainStartEndE-ValueType
low complexity region 16 40 N/A INTRINSIC
Pfam:DUF4605 41 100 9.6e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000050103
AA Change: I172S

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000054054
Gene: ENSMUSG00000044312
AA Change: I172S

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
low complexity region 59 70 N/A INTRINSIC
HLH 89 141 7.94e-18 SMART
low complexity region 156 171 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141724
SMART Domains Protein: ENSMUSP00000119343
Gene: ENSMUSG00000020083

DomainStartEndE-ValueType
low complexity region 40 54 N/A INTRINSIC
low complexity region 59 83 N/A INTRINSIC
Pfam:DUF4605 84 123 6.6e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150057
Predicted Effect probably benign
Transcript: ENSMUST00000156798
SMART Domains Protein: ENSMUSP00000115712
Gene: ENSMUSG00000020083

DomainStartEndE-ValueType
low complexity region 17 31 N/A INTRINSIC
low complexity region 36 60 N/A INTRINSIC
Pfam:DUF4605 61 100 3e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218121
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a basic helix-loop-helix (bHLH) transcription factor involved in neurogenesis. The encoded protein likely acts as a heterodimer with another bHLH protein. Defects in this gene are a cause of congenital malabsorptive diarrhea 4 (DIAR4).[provided by RefSeq, May 2010]
PHENOTYPE: Homozygotes for targeted null mutations are deficient in endocrine cells of the glandular stomach and intestinal epithelium, and lack glucagon- and insulin-producing cells of the pancreas. Mutants die postnatally from diabetes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930516K23Rik T C 7: 104,059,263 E113G probably damaging Het
Adamts8 A G 9: 30,959,064 E650G probably damaging Het
Adgrg7 G A 16: 56,750,429 T412M probably damaging Het
Ank2 C T 3: 126,988,159 V7I possibly damaging Het
Bpifb1 G A 2: 154,213,111 V308M probably damaging Het
C3 A G 17: 57,206,220 S1476P probably benign Het
Dgkb A T 12: 37,981,790 probably benign Het
Fmn1 A G 2: 113,529,310 probably null Het
Foxb1 G A 9: 69,759,859 Q130* probably null Het
Gemin5 C T 11: 58,130,402 probably null Het
Ghr T A 15: 3,319,914 D594V possibly damaging Het
Gm10272 A C 10: 77,706,626 M1L unknown Het
Gm11239 C T 4: 73,668,411 probably benign Het
Gpr161 G A 1: 165,318,835 V447M probably damaging Het
Hspg2 T A 4: 137,541,440 S2157T possibly damaging Het
Irs1 A G 1: 82,288,002 V831A not run Het
Itga8 T A 2: 12,111,037 I1014L possibly damaging Het
Iws1 T A 18: 32,080,483 S321R possibly damaging Het
Kctd19 G T 8: 105,386,935 P702Q probably benign Het
Man2c1 G A 9: 57,140,275 D739N probably damaging Het
Mboat4 T A 8: 34,124,024 L205Q probably damaging Het
Meis3 C A 7: 16,177,493 Y38* probably null Het
Mroh7 G T 4: 106,720,398 T361K possibly damaging Het
Myl6b T A 10: 128,496,280 K106* probably null Het
Naaa T A 5: 92,263,724 T241S probably benign Het
Nub1 T G 5: 24,701,529 I351R probably damaging Het
Olfr328 C A 11: 58,551,631 V203L possibly damaging Het
Olfr402 A T 11: 74,155,588 R145W probably benign Het
Olfr777 A T 10: 129,269,134 F63Y probably benign Het
Osbp2 T C 11: 3,717,944 K18E probably damaging Het
Pcdh8 A T 14: 79,771,103 W7R probably benign Het
Pcsk7 G T 9: 45,927,673 probably null Het
Plin4 G A 17: 56,104,883 T716I probably damaging Het
Prkcb G A 7: 122,568,134 V356I probably damaging Het
Pus7 G A 5: 23,760,246 T304I probably damaging Het
Rmnd1 A G 10: 4,403,989 V402A probably damaging Het
Slmap T C 14: 26,460,191 E329G probably damaging Het
Sytl3 T C 17: 6,681,947 probably benign Het
Tg A G 15: 66,689,927 I1087V probably benign Het
Tmco1 A G 1: 167,326,003 T162A Het
Tti1 G A 2: 158,007,996 T441I probably benign Het
Tubgcp6 G T 15: 89,102,323 Q1366K possibly damaging Het
Ush1g T C 11: 115,318,573 K265R probably benign Het
Zdhhc8 A G 16: 18,227,810 V209A probably damaging Het
Zfp160 T A 17: 21,025,660 Y157* probably null Het
Zfp423 A T 8: 87,688,067 C1208S possibly damaging Het
Zfyve26 A T 12: 79,268,676 V1342E probably damaging Het
Zmym1 A T 4: 127,048,757 C613S probably benign Het
Other mutations in Neurog3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4592:Neurog3 UTSW 10 62133820 missense probably damaging 1.00
R5277:Neurog3 UTSW 10 62133853 missense probably damaging 1.00
R7076:Neurog3 UTSW 10 62133580 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCGGATGACGCCAAACTTAC -3'
(R):5'- CCTAGTTAAGCCCTGTGAGAG -3'

Sequencing Primer
(F):5'- TTACAAAGATCGAGACCCTGCG -3'
(R):5'- GCTTGAGAGCCTCCACTAC -3'
Posted On2019-10-17