Incidental Mutation 'R0617:Setx'
ID58385
Institutional Source Beutler Lab
Gene Symbol Setx
Ensembl Gene ENSMUSG00000043535
Gene Namesenataxin
SynonymsA930037J23Rik, Als4
MMRRC Submission 038806-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0617 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location29124181-29182471 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 29146807 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 1101 (H1101Q)
Ref Sequence ENSEMBL: ENSMUSP00000051492 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061578]
Predicted Effect possibly damaging
Transcript: ENSMUST00000061578
AA Change: H1101Q

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000051492
Gene: ENSMUSG00000043535
AA Change: H1101Q

DomainStartEndE-ValueType
low complexity region 864 876 N/A INTRINSIC
low complexity region 1002 1020 N/A INTRINSIC
low complexity region 1058 1079 N/A INTRINSIC
low complexity region 1575 1594 N/A INTRINSIC
Pfam:AAA_11 1909 2194 1.9e-68 PFAM
Pfam:AAA_19 1924 2015 2.9e-11 PFAM
Pfam:AAA_12 2201 2402 1.1e-54 PFAM
low complexity region 2499 2516 N/A INTRINSIC
low complexity region 2576 2587 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.5%
Validation Efficiency 98% (130/133)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein named for its homology to the Sen1p protein of fungi which has RNA helicase activity encoded by a domain at the C-terminal end of the protein. The protein encoded by this gene contains a DNA/RNA helicase domain at its C-terminal end which suggests that it may be involved in both DNA and RNA processing. Mutations in this gene have been associated with ataxia-ocular apraxia-2 (AOA2) and an autosomal dominant form of juvenile amyotrophic lateral sclerosis (ALS4). [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility due to arrested male meiosis and reduced female fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 130 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik C A 19: 11,112,400 L40F probably damaging Het
4930555F03Rik A T 8: 49,500,492 noncoding transcript Het
A630073D07Rik T C 6: 132,626,737 probably benign Het
Abca16 G A 7: 120,433,611 probably benign Het
Abca5 A T 11: 110,279,689 D1265E probably damaging Het
Abcf1 C T 17: 35,961,187 V312I probably benign Het
Abhd12 T A 2: 150,846,365 probably null Het
Adam23 A G 1: 63,543,147 H318R probably benign Het
Adcy2 T A 13: 68,678,606 K660* probably null Het
Adgrf3 T C 5: 30,195,080 T972A probably benign Het
Adipoq T A 16: 23,155,410 D62E probably damaging Het
Akap2 T C 4: 57,829,434 probably benign Het
Alk G T 17: 72,603,583 P43T probably damaging Het
Arap2 AT ATT 5: 62,649,907 probably benign Het
Arhgef28 G T 13: 97,970,355 T687K probably benign Het
Arrb1 T C 7: 99,594,677 L278P probably damaging Het
Atad2b C A 12: 4,937,401 D76E probably benign Het
Atm A T 9: 53,458,941 Y2290* probably null Het
Atrn T A 2: 130,995,085 probably null Het
Bpifb1 A G 2: 154,212,947 D253G possibly damaging Het
Bpifb9b C T 2: 154,319,625 T559M probably benign Het
Bsn T C 9: 108,107,240 E3205G unknown Het
Cacna1c T C 6: 118,602,213 Y1599C probably damaging Het
Ccdc40 A G 11: 119,242,804 D590G probably damaging Het
Ccdc68 A G 18: 69,946,552 probably null Het
Ccdc97 G A 7: 25,714,420 R279C probably damaging Het
Ccm2l A G 2: 153,070,900 T120A probably damaging Het
Cfap54 T C 10: 92,829,650 probably benign Het
Cfh A G 1: 140,100,883 S1043P probably benign Het
Chil3 T C 3: 106,155,756 K173E probably benign Het
Cib2 T C 9: 54,554,496 D26G possibly damaging Het
Col24a1 T C 3: 145,314,120 V84A probably damaging Het
Csn3 T C 5: 87,929,871 Y79H probably benign Het
Ddx47 T A 6: 135,017,122 V149E probably damaging Het
Dennd5b A T 6: 149,033,262 probably benign Het
Desi1 T C 15: 81,998,198 N109D probably damaging Het
Fam13c T C 10: 70,536,352 probably benign Het
Fam234a A T 17: 26,216,617 D264E probably benign Het
Fanca A G 8: 123,288,070 F831S probably damaging Het
Fancm C T 12: 65,097,317 R518* probably null Het
Fat2 A G 11: 55,311,843 V135A possibly damaging Het
Fbxl17 A C 17: 63,384,992 F42V probably damaging Het
Fgd3 A T 13: 49,264,697 V631E possibly damaging Het
Fhod3 G A 18: 25,112,679 probably benign Het
Focad T C 4: 88,121,288 probably benign Het
Foxn4 C A 5: 114,261,068 probably benign Het
Gm1673 T C 5: 33,983,552 probably benign Het
Gm2381 A T 7: 42,819,978 C241S probably damaging Het
Gm6483 T G 8: 19,693,709 F117V probably damaging Het
Hectd4 T C 5: 121,343,232 probably benign Het
Hecw1 T A 13: 14,280,442 Q676L probably benign Het
Hipk2 G A 6: 38,747,485 R437C possibly damaging Het
Ifnar1 T C 16: 91,501,682 Y396H probably damaging Het
Ints5 A T 19: 8,896,019 K447N probably damaging Het
Iqsec1 T C 6: 90,689,970 Y495C probably damaging Het
Itga5 C T 15: 103,356,315 probably null Het
Kcnk4 T A 19: 6,928,160 probably benign Het
Kmo A G 1: 175,647,190 T174A possibly damaging Het
Krt36 T C 11: 100,102,275 D458G probably damaging Het
Krtap16-1 G T 11: 99,986,495 P28T probably damaging Het
Lama3 T C 18: 12,419,258 probably null Het
Lrrc9 T C 12: 72,483,014 S920P probably damaging Het
Lrrk2 A T 15: 91,752,278 Y1485F probably benign Het
Mical1 C T 10: 41,481,315 A372V probably damaging Het
Mtr C T 13: 12,221,432 R636Q probably benign Het
Muc4 A T 16: 32,752,107 T662S possibly damaging Het
Myo10 G A 15: 25,738,005 V546M probably damaging Het
Nbeal1 G A 1: 60,281,832 W2034* probably null Het
Nhlrc3 T C 3: 53,458,623 T150A probably damaging Het
Nkx2-1 T C 12: 56,534,855 H69R possibly damaging Het
Nlrp4g A T 9: 124,349,540 noncoding transcript Het
Nod2 A G 8: 88,653,231 N120S probably benign Het
Nol8 T C 13: 49,654,445 F46L possibly damaging Het
Ntrk1 T C 3: 87,783,933 D308G possibly damaging Het
Olfr1036 A G 2: 86,075,141 M134V probably benign Het
Olfr1124 A G 2: 87,434,661 D58G probably damaging Het
Olfr1196 A G 2: 88,700,696 V211A probably damaging Het
Olfr1459 T C 19: 13,146,363 M99V probably benign Het
Olfr1477 C A 19: 13,502,536 N64K probably damaging Het
Olfr313 T C 11: 58,817,149 V47A probably damaging Het
Olfr466 A T 13: 65,152,878 Y218F possibly damaging Het
Olfr640 A T 7: 104,021,989 S110T probably damaging Het
Oog3 A T 4: 144,160,214 V112D probably benign Het
Pcdhb8 C T 18: 37,357,047 R593C probably benign Het
Pgm3 A G 9: 86,556,190 probably null Het
Pirt T A 11: 66,926,172 V103E probably damaging Het
Plxnc1 T A 10: 94,799,368 D1332V probably damaging Het
Ppfia4 A T 1: 134,328,780 V122E probably damaging Het
Pramef17 A G 4: 143,993,518 probably benign Het
Prmt2 C T 10: 76,208,683 probably benign Het
Prrc2a G T 17: 35,153,560 P1702T probably damaging Het
Prss39 A T 1: 34,500,198 H173L probably damaging Het
Rabl6 A G 2: 25,586,866 probably null Het
Rb1cc1 T A 1: 6,248,790 I794K possibly damaging Het
Reln T C 5: 21,920,537 D2716G probably damaging Het
Sbf2 ACC AC 7: 110,330,683 probably null Het
Sema6d T A 2: 124,660,745 F583L possibly damaging Het
Sis A G 3: 72,965,605 C67R probably damaging Het
Skint1 T A 4: 112,029,399 probably benign Het
Smg6 C A 11: 75,162,931 T1413K probably benign Het
Spata31d1a A T 13: 59,702,259 I685N possibly damaging Het
Spef2 T A 15: 9,592,758 N1499I probably damaging Het
Stk11ip T A 1: 75,532,288 probably null Het
Stxbp1 A C 2: 32,802,783 I407S probably damaging Het
Svil T C 18: 5,117,002 S2059P probably damaging Het
Syne1 C T 10: 5,350,933 V932M probably damaging Het
Tacc1 A C 8: 25,178,004 probably benign Het
Tbc1d13 C A 2: 30,135,564 probably benign Het
Tbc1d15 A C 10: 115,239,299 D59E probably damaging Het
Tcaf2 A G 6: 42,642,511 F194S probably damaging Het
Terf2ip T A 8: 112,011,495 M5K probably benign Het
Tgfbr2 A T 9: 116,158,320 D40E probably benign Het
Tm4sf5 T A 11: 70,510,669 S165T probably damaging Het
Tmprss3 A T 17: 31,193,912 C129S probably damaging Het
Tmx2 T C 2: 84,672,396 D256G probably benign Het
Tnr A G 1: 159,868,103 D532G probably damaging Het
Tnrc18 T A 5: 142,776,739 H465L unknown Het
Togaram2 A T 17: 71,700,509 Q350L possibly damaging Het
Topaz1 G A 9: 122,749,906 C627Y possibly damaging Het
Tpx2 A T 2: 152,873,138 Q93L probably benign Het
Trim54 T C 5: 31,136,182 probably null Het
Troap T A 15: 99,082,660 C574S probably damaging Het
Ubr4 T C 4: 139,479,062 probably null Het
Vmn2r51 A G 7: 10,100,469 V214A possibly damaging Het
Vmn2r66 A T 7: 84,995,276 M642K probably benign Het
Vwa5a T A 9: 38,723,895 I232N probably damaging Het
Zcchc6 A T 13: 59,816,855 probably null Het
Zfp820 A T 17: 21,819,704 S214R probably damaging Het
Zfp955b A T 17: 33,305,463 S43R probably damaging Het
Zgrf1 C T 3: 127,588,038 T1162M probably benign Het
Other mutations in Setx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00688:Setx APN 2 29148445 missense possibly damaging 0.50
IGL00806:Setx APN 2 29127026 missense probably damaging 1.00
IGL01346:Setx APN 2 29144809 missense probably damaging 1.00
IGL01623:Setx APN 2 29163009 missense possibly damaging 0.70
IGL02351:Setx APN 2 29146964 missense probably benign 0.45
IGL02358:Setx APN 2 29146964 missense probably benign 0.45
IGL02378:Setx APN 2 29173726 splice site probably benign
IGL02388:Setx APN 2 29173653 missense probably damaging 1.00
IGL02408:Setx APN 2 29133930 missense probably damaging 1.00
IGL02425:Setx APN 2 29148408 missense probably benign 0.00
IGL03023:Setx APN 2 29145902 missense probably benign 0.02
IGL03351:Setx APN 2 29161799 missense probably benign 0.25
Addison UTSW 2 29158905 missense probably damaging 1.00
dallas UTSW 2 29154061 frame shift probably null
Denton UTSW 2 29145060 missense possibly damaging 0.81
doggie UTSW 2 29164550 missense probably damaging 1.00
Irving UTSW 2 29139221 missense probably damaging 0.99
IGL03014:Setx UTSW 2 29139411 missense probably damaging 1.00
PIT4403001:Setx UTSW 2 29133955 missense probably damaging 1.00
R0027:Setx UTSW 2 29139221 missense probably damaging 0.99
R0031:Setx UTSW 2 29176929 missense probably benign 0.02
R0070:Setx UTSW 2 29161525 missense probably benign 0.00
R0070:Setx UTSW 2 29161525 missense probably benign 0.00
R0092:Setx UTSW 2 29146293 missense probably benign 0.00
R0193:Setx UTSW 2 29179673 missense probably benign 0.21
R0281:Setx UTSW 2 29179643 missense probably benign 0.00
R0401:Setx UTSW 2 29166289 nonsense probably null
R0413:Setx UTSW 2 29139278 missense probably damaging 1.00
R0517:Setx UTSW 2 29157133 missense probably benign 0.00
R0536:Setx UTSW 2 29158248 missense possibly damaging 0.46
R1183:Setx UTSW 2 29180092 missense probably benign
R1331:Setx UTSW 2 29179686 missense probably benign
R1465:Setx UTSW 2 29140389 critical splice donor site probably null
R1465:Setx UTSW 2 29140389 critical splice donor site probably null
R1467:Setx UTSW 2 29158905 missense probably damaging 1.00
R1467:Setx UTSW 2 29158905 missense probably damaging 1.00
R1482:Setx UTSW 2 29162992 missense probably damaging 0.99
R1599:Setx UTSW 2 29140373 missense probably benign 0.04
R1663:Setx UTSW 2 29126905 missense probably damaging 1.00
R1909:Setx UTSW 2 29163009 missense possibly damaging 0.70
R2117:Setx UTSW 2 29130301 missense probably benign 0.01
R2207:Setx UTSW 2 29154061 frame shift probably null
R2221:Setx UTSW 2 29154061 frame shift probably null
R2223:Setx UTSW 2 29148537 missense possibly damaging 0.89
R2223:Setx UTSW 2 29154061 frame shift probably null
R2273:Setx UTSW 2 29154061 frame shift probably null
R2274:Setx UTSW 2 29154061 frame shift probably null
R2275:Setx UTSW 2 29154061 frame shift probably null
R2309:Setx UTSW 2 29158904 missense probably damaging 1.00
R2328:Setx UTSW 2 29154060 frame shift probably null
R2328:Setx UTSW 2 29154061 frame shift probably null
R2329:Setx UTSW 2 29154061 frame shift probably null
R2331:Setx UTSW 2 29154061 frame shift probably null
R2332:Setx UTSW 2 29154061 frame shift probably null
R2429:Setx UTSW 2 29179898 missense probably benign 0.00
R2438:Setx UTSW 2 29154061 frame shift probably null
R2439:Setx UTSW 2 29154061 frame shift probably null
R2496:Setx UTSW 2 29144801 missense probably benign 0.11
R2858:Setx UTSW 2 29154061 frame shift probably null
R2859:Setx UTSW 2 29154061 frame shift probably null
R2884:Setx UTSW 2 29148625 missense probably damaging 0.98
R2885:Setx UTSW 2 29148625 missense probably damaging 0.98
R2886:Setx UTSW 2 29148625 missense probably damaging 0.98
R2915:Setx UTSW 2 29172324 missense probably damaging 0.99
R2921:Setx UTSW 2 29154060 small deletion probably benign
R2921:Setx UTSW 2 29154061 frame shift probably null
R2923:Setx UTSW 2 29154061 frame shift probably null
R3426:Setx UTSW 2 29154061 frame shift probably null
R3609:Setx UTSW 2 29154061 frame shift probably null
R3610:Setx UTSW 2 29154061 frame shift probably null
R3731:Setx UTSW 2 29154061 frame shift probably null
R3813:Setx UTSW 2 29154061 frame shift probably null
R3835:Setx UTSW 2 29145060 missense possibly damaging 0.81
R3871:Setx UTSW 2 29145741 missense probably damaging 0.98
R4013:Setx UTSW 2 29154061 frame shift probably null
R4014:Setx UTSW 2 29154061 frame shift probably null
R4015:Setx UTSW 2 29154061 frame shift probably null
R4017:Setx UTSW 2 29154061 frame shift probably null
R4246:Setx UTSW 2 29154061 frame shift probably null
R4248:Setx UTSW 2 29154061 frame shift probably null
R4297:Setx UTSW 2 29154061 frame shift probably null
R4298:Setx UTSW 2 29154061 frame shift probably null
R4539:Setx UTSW 2 29179748 missense probably benign 0.14
R4590:Setx UTSW 2 29144809 missense probably damaging 1.00
R4632:Setx UTSW 2 29148615 missense probably benign 0.23
R4782:Setx UTSW 2 29144046 missense probably damaging 0.99
R4801:Setx UTSW 2 29146373 missense probably benign 0.14
R4802:Setx UTSW 2 29146373 missense probably benign 0.14
R4975:Setx UTSW 2 29164550 missense probably damaging 1.00
R5040:Setx UTSW 2 29139338 missense probably damaging 1.00
R5133:Setx UTSW 2 29180081 missense probably benign 0.02
R5208:Setx UTSW 2 29166367 missense possibly damaging 0.63
R5237:Setx UTSW 2 29146983 missense probably benign 0.00
R5248:Setx UTSW 2 29148418 missense probably benign 0.26
R5288:Setx UTSW 2 29134033 critical splice donor site probably null
R5385:Setx UTSW 2 29134033 critical splice donor site probably null
R5387:Setx UTSW 2 29147594 missense probably benign 0.00
R5407:Setx UTSW 2 29145474 missense probably benign 0.00
R5685:Setx UTSW 2 29171280 missense probably damaging 1.00
R6110:Setx UTSW 2 29140290 missense probably damaging 1.00
R6136:Setx UTSW 2 29148027 missense probably benign 0.01
R6310:Setx UTSW 2 29176935 missense possibly damaging 0.57
R6328:Setx UTSW 2 29174462 intron probably benign
R6358:Setx UTSW 2 29171348 missense possibly damaging 0.79
R6384:Setx UTSW 2 29173558 missense probably damaging 1.00
R6400:Setx UTSW 2 29130274 missense probably damaging 0.97
R6572:Setx UTSW 2 29173694 missense possibly damaging 0.63
R6662:Setx UTSW 2 29158114 missense probably damaging 0.97
R6898:Setx UTSW 2 29148108 missense probably benign 0.00
R7188:Setx UTSW 2 29148172 missense probably benign 0.02
R7332:Setx UTSW 2 29146626 missense probably benign 0.00
R7357:Setx UTSW 2 29130301 missense probably benign 0.01
R7556:Setx UTSW 2 29146493 missense possibly damaging 0.88
R7646:Setx UTSW 2 29177549 missense possibly damaging 0.94
X0066:Setx UTSW 2 29147879 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCAGTTAATGCCAGTGTGGAGAAGC -3'
(R):5'- ACACTTGAACTGGGAGTTGCCATC -3'

Sequencing Primer
(F):5'- CAGTGTGGAGAAGCAGCTTG -3'
(R):5'- TAAGATCTCTGCGATCAGGC -3'
Posted On2013-07-11