Incidental Mutation 'R7540:Myl6b'
ID583850
Institutional Source Beutler Lab
Gene Symbol Myl6b
Ensembl Gene ENSMUSG00000039824
Gene Namemyosin, light polypeptide 6B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R7540 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location128494157-128498685 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 128496280 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 106 (K106*)
Ref Sequence ENSEMBL: ENSMUSP00000026428 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026428] [ENSMUST00000164181] [ENSMUST00000217733] [ENSMUST00000217776] [ENSMUST00000217969] [ENSMUST00000218127] [ENSMUST00000219236] [ENSMUST00000220307] [ENSMUST00000220427]
Predicted Effect probably null
Transcript: ENSMUST00000026428
AA Change: K106*
SMART Domains Protein: ENSMUSP00000026428
Gene: ENSMUSG00000039824
AA Change: K106*

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 31 50 N/A INTRINSIC
EFh 67 95 5.08e-3 SMART
EFh 144 172 6.38e0 SMART
Blast:EFh 179 207 9e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000164181
SMART Domains Protein: ENSMUSP00000128803
Gene: ENSMUSG00000090841

DomainStartEndE-ValueType
EFh 11 39 8.98e-4 SMART
EFh 88 116 3.64e1 SMART
EFh 123 151 6.63e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000217733
Predicted Effect probably benign
Transcript: ENSMUST00000217776
Predicted Effect probably benign
Transcript: ENSMUST00000217969
Predicted Effect probably benign
Transcript: ENSMUST00000218127
Predicted Effect probably benign
Transcript: ENSMUST00000219236
Predicted Effect probably benign
Transcript: ENSMUST00000220307
Predicted Effect probably benign
Transcript: ENSMUST00000220427
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Myosin is a hexameric ATPase cellular motor protein. It is composed of two heavy chains, two nonphosphorylatable alkali light chains, and two phosphorylatable regulatory light chains. This gene encodes a myosin alkali light chain expressed in both slow-twitch skeletal muscle and in nonmuscle tissue. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930516K23Rik T C 7: 104,059,263 E113G probably damaging Het
Adamts8 A G 9: 30,959,064 E650G probably damaging Het
Adgrg7 G A 16: 56,750,429 T412M probably damaging Het
Ank2 C T 3: 126,988,159 V7I possibly damaging Het
Bpifb1 G A 2: 154,213,111 V308M probably damaging Het
C3 A G 17: 57,206,220 S1476P probably benign Het
Dgkb A T 12: 37,981,790 probably benign Het
Fmn1 A G 2: 113,529,310 probably null Het
Foxb1 G A 9: 69,759,859 Q130* probably null Het
Gemin5 C T 11: 58,130,402 probably null Het
Ghr T A 15: 3,319,914 D594V possibly damaging Het
Gm10272 A C 10: 77,706,626 M1L unknown Het
Gm11239 C T 4: 73,668,411 probably benign Het
Gpr161 G A 1: 165,318,835 V447M probably damaging Het
Hspg2 T A 4: 137,541,440 S2157T possibly damaging Het
Irs1 A G 1: 82,288,002 V831A not run Het
Itga8 T A 2: 12,111,037 I1014L possibly damaging Het
Iws1 T A 18: 32,080,483 S321R possibly damaging Het
Kctd19 G T 8: 105,386,935 P702Q probably benign Het
Man2c1 G A 9: 57,140,275 D739N probably damaging Het
Mboat4 T A 8: 34,124,024 L205Q probably damaging Het
Meis3 C A 7: 16,177,493 Y38* probably null Het
Mroh7 G T 4: 106,720,398 T361K possibly damaging Het
Naaa T A 5: 92,263,724 T241S probably benign Het
Neurog3 T G 10: 62,133,977 I172S probably benign Het
Nub1 T G 5: 24,701,529 I351R probably damaging Het
Olfr328 C A 11: 58,551,631 V203L possibly damaging Het
Olfr402 A T 11: 74,155,588 R145W probably benign Het
Olfr777 A T 10: 129,269,134 F63Y probably benign Het
Osbp2 T C 11: 3,717,944 K18E probably damaging Het
Pcdh8 A T 14: 79,771,103 W7R probably benign Het
Pcsk7 G T 9: 45,927,673 probably null Het
Plin4 G A 17: 56,104,883 T716I probably damaging Het
Prkcb G A 7: 122,568,134 V356I probably damaging Het
Pus7 G A 5: 23,760,246 T304I probably damaging Het
Rmnd1 A G 10: 4,403,989 V402A probably damaging Het
Slmap T C 14: 26,460,191 E329G probably damaging Het
Sytl3 T C 17: 6,681,947 probably benign Het
Tg A G 15: 66,689,927 I1087V probably benign Het
Tmco1 A G 1: 167,326,003 T162A Het
Tti1 G A 2: 158,007,996 T441I probably benign Het
Tubgcp6 G T 15: 89,102,323 Q1366K possibly damaging Het
Ush1g T C 11: 115,318,573 K265R probably benign Het
Zdhhc8 A G 16: 18,227,810 V209A probably damaging Het
Zfp160 T A 17: 21,025,660 Y157* probably null Het
Zfp423 A T 8: 87,688,067 C1208S possibly damaging Het
Zfyve26 A T 12: 79,268,676 V1342E probably damaging Het
Zmym1 A T 4: 127,048,757 C613S probably benign Het
Other mutations in Myl6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01730:Myl6b APN 10 128496342 missense possibly damaging 0.54
IGL02257:Myl6b APN 10 128497341 unclassified probably benign
PIT4260001:Myl6b UTSW 10 128496306 missense possibly damaging 0.48
R1971:Myl6b UTSW 10 128494643 missense probably damaging 0.98
R5476:Myl6b UTSW 10 128497347 unclassified probably benign
R6361:Myl6b UTSW 10 128497209 nonsense probably null
R7149:Myl6b UTSW 10 128497199 critical splice donor site probably null
R8221:Myl6b UTSW 10 128497340 missense unknown
Predicted Primers PCR Primer
(F):5'- TGGCCAACCTGAGTAATTTGG -3'
(R):5'- TTCTGAAGCAAACCTCCCTC -3'

Sequencing Primer
(F):5'- CAGTACCTCTGTAATAAGGGCTTGC -3'
(R):5'- GAAGCAAACCTCCCTCTCTCTG -3'
Posted On2019-10-17