Incidental Mutation 'R7540:Osbp2'
ID583852
Institutional Source Beutler Lab
Gene Symbol Osbp2
Ensembl Gene ENSMUSG00000020435
Gene Nameoxysterol binding protein 2
SynonymsOSBPL1, 1700095P05Rik, C630001G20Rik, ORP-4
MMRRC Submission
Accession Numbers

Genbank: NM_152818; MGI: 1921559

Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R7540 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location3703731-3863903 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3717944 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 18 (K18E)
Ref Sequence ENSEMBL: ENSMUSP00000116490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070552] [ENSMUST00000101632] [ENSMUST00000102950] [ENSMUST00000127371] [ENSMUST00000155197]
Predicted Effect probably damaging
Transcript: ENSMUST00000070552
AA Change: K382E

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000068652
Gene: ENSMUSG00000020435
AA Change: K382E

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
PH 180 273 1.12e-16 SMART
low complexity region 281 311 N/A INTRINSIC
Blast:PH 312 394 1e-32 BLAST
low complexity region 424 437 N/A INTRINSIC
Pfam:Oxysterol_BP 519 894 3.5e-142 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101632
SMART Domains Protein: ENSMUSP00000099156
Gene: ENSMUSG00000020435

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:Oxysterol_BP 108 484 2.1e-132 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102950
SMART Domains Protein: ENSMUSP00000100015
Gene: ENSMUSG00000020435

DomainStartEndE-ValueType
Pfam:Oxysterol_BP 66 442 2.8e-132 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000127371
AA Change: K125E

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000116361
Gene: ENSMUSG00000020435
AA Change: K125E

DomainStartEndE-ValueType
low complexity region 24 39 N/A INTRINSIC
low complexity region 41 54 N/A INTRINSIC
Blast:PH 55 137 8e-37 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000155197
AA Change: K18E

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to the oxysterol-binding protein-related family of proteins, which are defined by a C-terminal sterol domain with a highly conserved EQVSHHPP motif. Oxysterols are oxygenated derivatives of cholesterol that are involved in mechanisms that include apoptosis, cholesterol homeostasis, lipid trafficking and cell differentiation. This protein is selectively expressed at high levels in the brain and testis. Within the testis, the mRNA is localized to postmeiotic germ cells, including spermatids and spermatozoa, but is not detectable in somatic cells. Mice homozygous mutant for a targeted deletion in this gene do not exhibit overt developmental phenotypes but are male sterile. Females display normal fertility. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility with sperm defects including oligozoospermia, teratozoospermia, asthenozoospermia and abnormal spermiogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930516K23Rik T C 7: 104,059,263 E113G probably damaging Het
Adamts8 A G 9: 30,959,064 E650G probably damaging Het
Adgrg7 G A 16: 56,750,429 T412M probably damaging Het
Ank2 C T 3: 126,988,159 V7I possibly damaging Het
Bpifb1 G A 2: 154,213,111 V308M probably damaging Het
C3 A G 17: 57,206,220 S1476P probably benign Het
Dgkb A T 12: 37,981,790 probably benign Het
Fmn1 A G 2: 113,529,310 probably null Het
Foxb1 G A 9: 69,759,859 Q130* probably null Het
Gemin5 C T 11: 58,130,402 probably null Het
Ghr T A 15: 3,319,914 D594V possibly damaging Het
Gm10272 A C 10: 77,706,626 M1L unknown Het
Gm11239 C T 4: 73,668,411 probably benign Het
Gpr161 G A 1: 165,318,835 V447M probably damaging Het
Hspg2 T A 4: 137,541,440 S2157T possibly damaging Het
Irs1 A G 1: 82,288,002 V831A not run Het
Itga8 T A 2: 12,111,037 I1014L possibly damaging Het
Iws1 T A 18: 32,080,483 S321R possibly damaging Het
Kctd19 G T 8: 105,386,935 P702Q probably benign Het
Man2c1 G A 9: 57,140,275 D739N probably damaging Het
Mboat4 T A 8: 34,124,024 L205Q probably damaging Het
Meis3 C A 7: 16,177,493 Y38* probably null Het
Mroh7 G T 4: 106,720,398 T361K possibly damaging Het
Myl6b T A 10: 128,496,280 K106* probably null Het
Naaa T A 5: 92,263,724 T241S probably benign Het
Neurog3 T G 10: 62,133,977 I172S probably benign Het
Nub1 T G 5: 24,701,529 I351R probably damaging Het
Olfr328 C A 11: 58,551,631 V203L possibly damaging Het
Olfr402 A T 11: 74,155,588 R145W probably benign Het
Olfr777 A T 10: 129,269,134 F63Y probably benign Het
Pcdh8 A T 14: 79,771,103 W7R probably benign Het
Pcsk7 G T 9: 45,927,673 probably null Het
Plin4 G A 17: 56,104,883 T716I probably damaging Het
Prkcb G A 7: 122,568,134 V356I probably damaging Het
Pus7 G A 5: 23,760,246 T304I probably damaging Het
Rmnd1 A G 10: 4,403,989 V402A probably damaging Het
Slmap T C 14: 26,460,191 E329G probably damaging Het
Sytl3 T C 17: 6,681,947 probably benign Het
Tg A G 15: 66,689,927 I1087V probably benign Het
Tmco1 A G 1: 167,326,003 T162A Het
Tti1 G A 2: 158,007,996 T441I probably benign Het
Tubgcp6 G T 15: 89,102,323 Q1366K possibly damaging Het
Ush1g T C 11: 115,318,573 K265R probably benign Het
Zdhhc8 A G 16: 18,227,810 V209A probably damaging Het
Zfp160 T A 17: 21,025,660 Y157* probably null Het
Zfp423 A T 8: 87,688,067 C1208S possibly damaging Het
Zfyve26 A T 12: 79,268,676 V1342E probably damaging Het
Zmym1 A T 4: 127,048,757 C613S probably benign Het
Other mutations in Osbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Osbp2 APN 11 3711848 missense probably benign 0.02
IGL00231:Osbp2 APN 11 3726561 missense possibly damaging 0.79
IGL01023:Osbp2 APN 11 3863387 missense probably benign
IGL01819:Osbp2 APN 11 3717127 missense probably damaging 1.00
IGL01931:Osbp2 APN 11 3705388 critical splice donor site probably null
IGL01933:Osbp2 APN 11 3712016 missense probably damaging 1.00
IGL02166:Osbp2 APN 11 3717983 missense probably damaging 1.00
IGL02751:Osbp2 APN 11 3863434 missense probably benign 0.20
IGL02812:Osbp2 APN 11 3714637 missense probably benign 0.00
IGL03289:Osbp2 APN 11 3863380 missense probably benign
3-1:Osbp2 UTSW 11 3863470 missense probably benign 0.11
R0035:Osbp2 UTSW 11 3717997 splice site probably benign
R0109:Osbp2 UTSW 11 3711791 missense probably benign 0.00
R0414:Osbp2 UTSW 11 3819932 missense probably damaging 1.00
R0491:Osbp2 UTSW 11 3714709 missense probably damaging 1.00
R0791:Osbp2 UTSW 11 3711882 splice site probably benign
R1473:Osbp2 UTSW 11 3717175 unclassified probably null
R1630:Osbp2 UTSW 11 3717167 missense probably benign 0.15
R1931:Osbp2 UTSW 11 3726333 unclassified probably null
R2697:Osbp2 UTSW 11 3863407 missense probably benign 0.00
R3799:Osbp2 UTSW 11 3717883 missense probably damaging 1.00
R4700:Osbp2 UTSW 11 3712160 missense probably damaging 1.00
R4718:Osbp2 UTSW 11 3711793 missense probably damaging 0.98
R4788:Osbp2 UTSW 11 3863320 missense probably benign 0.44
R5381:Osbp2 UTSW 11 3705593 missense probably benign 0.12
R5615:Osbp2 UTSW 11 3863356 missense probably benign 0.00
R5681:Osbp2 UTSW 11 3863486 missense probably benign
R6171:Osbp2 UTSW 11 3717221 splice site probably null
R6329:Osbp2 UTSW 11 3715153 missense probably damaging 1.00
R6861:Osbp2 UTSW 11 3715191 missense possibly damaging 0.68
R6987:Osbp2 UTSW 11 3717958 missense probably damaging 0.99
R7205:Osbp2 UTSW 11 3712134 missense probably damaging 1.00
R7316:Osbp2 UTSW 11 3726431 missense probably damaging 1.00
R7559:Osbp2 UTSW 11 3712493 missense probably damaging 1.00
R7830:Osbp2 UTSW 11 3863414 missense probably benign
R8085:Osbp2 UTSW 11 3712521 missense probably damaging 1.00
X0060:Osbp2 UTSW 11 3820035 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTATGGAGCCCAAGAGGTACAG -3'
(R):5'- AGGATGTTCCAGCAGACAGC -3'

Sequencing Primer
(F):5'- GCAGCGCTAGAATGCACC -3'
(R):5'- CTGAGGTCCTAGCTGTGATGAAC -3'
Posted On2019-10-17