Incidental Mutation 'R7540:Tubgcp6'
ID583862
Institutional Source Beutler Lab
Gene Symbol Tubgcp6
Ensembl Gene ENSMUSG00000051786
Gene Nametubulin, gamma complex associated protein 6
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R7540 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location89098357-89123112 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 89102323 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 1366 (Q1366K)
Ref Sequence ENSEMBL: ENSMUSP00000104977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041656] [ENSMUST00000082439] [ENSMUST00000109353] [ENSMUST00000130700] [ENSMUST00000166480]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041656
AA Change: Q1358K

PolyPhen 2 Score 0.799 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000040132
Gene: ENSMUSG00000051786
AA Change: Q1358K

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 355 1667 3.3e-119 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000082439
SMART Domains Protein: ENSMUSP00000081020
Gene: ENSMUSG00000035757

DomainStartEndE-ValueType
low complexity region 24 38 N/A INTRINSIC
Pfam:UPF0061 79 625 8.3e-131 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000109353
AA Change: Q1366K

PolyPhen 2 Score 0.482 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000104977
Gene: ENSMUSG00000051786
AA Change: Q1366K

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 355 1675 2.8e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130700
SMART Domains Protein: ENSMUSP00000138382
Gene: ENSMUSG00000035757

DomainStartEndE-ValueType
low complexity region 24 38 N/A INTRINSIC
Pfam:UPF0061 80 241 1.5e-39 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000131359
Gene: ENSMUSG00000051786
AA Change: Q48K

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 91 288 2.9e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166480
SMART Domains Protein: ENSMUSP00000132108
Gene: ENSMUSG00000051786

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 2 123 5e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169069
SMART Domains Protein: ENSMUSP00000132786
Gene: ENSMUSG00000051786

DomainStartEndE-ValueType
coiled coil region 77 107 N/A INTRINSIC
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of a large multisubunit complex required for microtubule nucleation at the centrosome. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930516K23Rik T C 7: 104,059,263 E113G probably damaging Het
Adamts8 A G 9: 30,959,064 E650G probably damaging Het
Adgrg7 G A 16: 56,750,429 T412M probably damaging Het
Ank2 C T 3: 126,988,159 V7I possibly damaging Het
Bpifb1 G A 2: 154,213,111 V308M probably damaging Het
C3 A G 17: 57,206,220 S1476P probably benign Het
Dgkb A T 12: 37,981,790 probably benign Het
Fmn1 A G 2: 113,529,310 probably null Het
Foxb1 G A 9: 69,759,859 Q130* probably null Het
Gemin5 C T 11: 58,130,402 probably null Het
Ghr T A 15: 3,319,914 D594V possibly damaging Het
Gm10272 A C 10: 77,706,626 M1L unknown Het
Gm11239 C T 4: 73,668,411 probably benign Het
Gpr161 G A 1: 165,318,835 V447M probably damaging Het
Hspg2 T A 4: 137,541,440 S2157T possibly damaging Het
Irs1 A G 1: 82,288,002 V831A not run Het
Itga8 T A 2: 12,111,037 I1014L possibly damaging Het
Iws1 T A 18: 32,080,483 S321R possibly damaging Het
Kctd19 G T 8: 105,386,935 P702Q probably benign Het
Man2c1 G A 9: 57,140,275 D739N probably damaging Het
Mboat4 T A 8: 34,124,024 L205Q probably damaging Het
Meis3 C A 7: 16,177,493 Y38* probably null Het
Mroh7 G T 4: 106,720,398 T361K possibly damaging Het
Myl6b T A 10: 128,496,280 K106* probably null Het
Naaa T A 5: 92,263,724 T241S probably benign Het
Neurog3 T G 10: 62,133,977 I172S probably benign Het
Nub1 T G 5: 24,701,529 I351R probably damaging Het
Olfr328 C A 11: 58,551,631 V203L possibly damaging Het
Olfr402 A T 11: 74,155,588 R145W probably benign Het
Olfr777 A T 10: 129,269,134 F63Y probably benign Het
Osbp2 T C 11: 3,717,944 K18E probably damaging Het
Pcdh8 A T 14: 79,771,103 W7R probably benign Het
Pcsk7 G T 9: 45,927,673 probably null Het
Plin4 G A 17: 56,104,883 T716I probably damaging Het
Prkcb G A 7: 122,568,134 V356I probably damaging Het
Pus7 G A 5: 23,760,246 T304I probably damaging Het
Rmnd1 A G 10: 4,403,989 V402A probably damaging Het
Slmap T C 14: 26,460,191 E329G probably damaging Het
Sytl3 T C 17: 6,681,947 probably benign Het
Tg A G 15: 66,689,927 I1087V probably benign Het
Tmco1 A G 1: 167,326,003 T162A Het
Tti1 G A 2: 158,007,996 T441I probably benign Het
Ush1g T C 11: 115,318,573 K265R probably benign Het
Zdhhc8 A G 16: 18,227,810 V209A probably damaging Het
Zfp160 T A 17: 21,025,660 Y157* probably null Het
Zfp423 A T 8: 87,688,067 C1208S possibly damaging Het
Zfyve26 A T 12: 79,268,676 V1342E probably damaging Het
Zmym1 A T 4: 127,048,757 C613S probably benign Het
Other mutations in Tubgcp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Tubgcp6 APN 15 89104008 missense probably benign 0.00
IGL00556:Tubgcp6 APN 15 89100962 missense probably damaging 1.00
IGL00943:Tubgcp6 APN 15 89122397 nonsense probably null
IGL01284:Tubgcp6 APN 15 89110055 missense probably damaging 1.00
IGL01363:Tubgcp6 APN 15 89107525 missense probably damaging 1.00
IGL01386:Tubgcp6 APN 15 89107996 nonsense probably null
IGL01792:Tubgcp6 APN 15 89101281 missense probably damaging 1.00
IGL01866:Tubgcp6 APN 15 89103488 missense probably benign 0.01
IGL02596:Tubgcp6 APN 15 89100914 missense probably damaging 1.00
IGL02858:Tubgcp6 APN 15 89102315 nonsense probably null
IGL02873:Tubgcp6 APN 15 89103824 missense probably benign 0.00
IGL03400:Tubgcp6 APN 15 89108099 unclassified probably benign
IGL02796:Tubgcp6 UTSW 15 89122390 missense probably benign 0.03
R0010:Tubgcp6 UTSW 15 89103183 missense probably benign 0.00
R0308:Tubgcp6 UTSW 15 89122436 missense possibly damaging 0.85
R0440:Tubgcp6 UTSW 15 89103065 missense probably benign 0.12
R0631:Tubgcp6 UTSW 15 89100987 missense probably damaging 1.00
R1653:Tubgcp6 UTSW 15 89107442 missense probably damaging 1.00
R1901:Tubgcp6 UTSW 15 89116241 missense possibly damaging 0.68
R1902:Tubgcp6 UTSW 15 89116241 missense possibly damaging 0.68
R1905:Tubgcp6 UTSW 15 89100608 missense probably damaging 1.00
R2005:Tubgcp6 UTSW 15 89104166 missense probably benign 0.01
R2067:Tubgcp6 UTSW 15 89104489 missense probably benign 0.03
R2083:Tubgcp6 UTSW 15 89122376 missense probably damaging 1.00
R2285:Tubgcp6 UTSW 15 89122474 missense probably damaging 1.00
R2401:Tubgcp6 UTSW 15 89102984 missense probably benign 0.22
R2436:Tubgcp6 UTSW 15 89102365 missense probably benign 0.37
R3017:Tubgcp6 UTSW 15 89103082 nonsense probably null
R3054:Tubgcp6 UTSW 15 89122603 missense probably damaging 1.00
R3932:Tubgcp6 UTSW 15 89104414 unclassified probably benign
R4350:Tubgcp6 UTSW 15 89103995 missense probably benign 0.00
R4472:Tubgcp6 UTSW 15 89103654 missense probably damaging 0.98
R4864:Tubgcp6 UTSW 15 89103818 missense probably benign
R4937:Tubgcp6 UTSW 15 89101549 missense probably damaging 0.98
R4983:Tubgcp6 UTSW 15 89106291 missense probably damaging 1.00
R4996:Tubgcp6 UTSW 15 89103490 missense possibly damaging 0.89
R5044:Tubgcp6 UTSW 15 89099545 unclassified probably benign
R5122:Tubgcp6 UTSW 15 89116103 missense probably damaging 1.00
R5607:Tubgcp6 UTSW 15 89111150 missense probably benign 0.02
R5608:Tubgcp6 UTSW 15 89111150 missense probably benign 0.02
R5653:Tubgcp6 UTSW 15 89108612 missense possibly damaging 0.47
R5886:Tubgcp6 UTSW 15 89103247 missense possibly damaging 0.82
R5945:Tubgcp6 UTSW 15 89109217 splice site probably null
R6111:Tubgcp6 UTSW 15 89100920 missense possibly damaging 0.83
R6195:Tubgcp6 UTSW 15 89122791 missense probably benign 0.01
R6792:Tubgcp6 UTSW 15 89122877 start gained probably benign
R7074:Tubgcp6 UTSW 15 89120636 missense probably damaging 1.00
R7103:Tubgcp6 UTSW 15 89101029 missense probably damaging 0.96
R7274:Tubgcp6 UTSW 15 89102970 nonsense probably null
R7275:Tubgcp6 UTSW 15 89102943 nonsense probably null
R7514:Tubgcp6 UTSW 15 89120525 missense probably damaging 1.00
R7571:Tubgcp6 UTSW 15 89100722 missense probably damaging 1.00
R7706:Tubgcp6 UTSW 15 89104223 missense probably benign
R7721:Tubgcp6 UTSW 15 89101401 missense probably damaging 1.00
R7996:Tubgcp6 UTSW 15 89109028 missense possibly damaging 0.92
R8095:Tubgcp6 UTSW 15 89122774 missense probably benign 0.07
R8191:Tubgcp6 UTSW 15 89120640 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGCTGACTGAACTTGGGG -3'
(R):5'- TCAGGAGTGTTCATGGAACG -3'

Sequencing Primer
(F):5'- CTGACTGAACTTGGGGGTCAAC -3'
(R):5'- CCACCACATGGGGTTTCC -3'
Posted On2019-10-17