Incidental Mutation 'R7540:Zfp160'
ID583865
Institutional Source Beutler Lab
Gene Symbol Zfp160
Ensembl Gene ENSMUSG00000067942
Gene Namezinc finger protein 160
Synonyms6720480D16Rik, 6720480D16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7540 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location21008903-21043070 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 21025660 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 157 (Y157*)
Ref Sequence ENSEMBL: ENSMUSP00000086191 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088811] [ENSMUST00000231482] [ENSMUST00000232320] [ENSMUST00000232354] [ENSMUST00000232473] [ENSMUST00000232595] [ENSMUST00000232663]
Predicted Effect probably null
Transcript: ENSMUST00000088811
AA Change: Y157*
SMART Domains Protein: ENSMUSP00000086191
Gene: ENSMUSG00000067942
AA Change: Y157*

DomainStartEndE-ValueType
KRAB 8 68 1.91e-29 SMART
low complexity region 100 110 N/A INTRINSIC
ZnF_C2H2 146 168 1.69e-3 SMART
ZnF_C2H2 174 196 2.91e-2 SMART
ZnF_C2H2 202 224 1.4e-4 SMART
ZnF_C2H2 230 252 3.89e-3 SMART
ZnF_C2H2 258 280 1.72e-4 SMART
ZnF_C2H2 286 308 4.94e-5 SMART
ZnF_C2H2 314 336 2.12e-4 SMART
ZnF_C2H2 342 364 1.12e-3 SMART
ZnF_C2H2 370 392 1.2e-3 SMART
ZnF_C2H2 398 420 6.42e-4 SMART
ZnF_C2H2 426 448 9.08e-4 SMART
ZnF_C2H2 454 476 1.84e-4 SMART
ZnF_C2H2 482 504 1.5e-4 SMART
ZnF_C2H2 510 532 3.44e-4 SMART
ZnF_C2H2 538 560 1.12e-3 SMART
ZnF_C2H2 566 588 2.27e-4 SMART
ZnF_C2H2 594 616 1.04e-3 SMART
ZnF_C2H2 622 644 1.13e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000231482
Predicted Effect probably benign
Transcript: ENSMUST00000232320
Predicted Effect probably null
Transcript: ENSMUST00000232354
AA Change: Y157*
Predicted Effect probably benign
Transcript: ENSMUST00000232473
Predicted Effect probably benign
Transcript: ENSMUST00000232595
Predicted Effect probably benign
Transcript: ENSMUST00000232663
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930516K23Rik T C 7: 104,059,263 E113G probably damaging Het
Adamts8 A G 9: 30,959,064 E650G probably damaging Het
Adgrg7 G A 16: 56,750,429 T412M probably damaging Het
Ank2 C T 3: 126,988,159 V7I possibly damaging Het
Bpifb1 G A 2: 154,213,111 V308M probably damaging Het
C3 A G 17: 57,206,220 S1476P probably benign Het
Dgkb A T 12: 37,981,790 probably benign Het
Fmn1 A G 2: 113,529,310 probably null Het
Foxb1 G A 9: 69,759,859 Q130* probably null Het
Gemin5 C T 11: 58,130,402 probably null Het
Ghr T A 15: 3,319,914 D594V possibly damaging Het
Gm10272 A C 10: 77,706,626 M1L unknown Het
Gm11239 C T 4: 73,668,411 probably benign Het
Gpr161 G A 1: 165,318,835 V447M probably damaging Het
Hspg2 T A 4: 137,541,440 S2157T possibly damaging Het
Irs1 A G 1: 82,288,002 V831A not run Het
Itga8 T A 2: 12,111,037 I1014L possibly damaging Het
Iws1 T A 18: 32,080,483 S321R possibly damaging Het
Kctd19 G T 8: 105,386,935 P702Q probably benign Het
Man2c1 G A 9: 57,140,275 D739N probably damaging Het
Mboat4 T A 8: 34,124,024 L205Q probably damaging Het
Meis3 C A 7: 16,177,493 Y38* probably null Het
Mroh7 G T 4: 106,720,398 T361K possibly damaging Het
Myl6b T A 10: 128,496,280 K106* probably null Het
Naaa T A 5: 92,263,724 T241S probably benign Het
Neurog3 T G 10: 62,133,977 I172S probably benign Het
Nub1 T G 5: 24,701,529 I351R probably damaging Het
Olfr328 C A 11: 58,551,631 V203L possibly damaging Het
Olfr402 A T 11: 74,155,588 R145W probably benign Het
Olfr777 A T 10: 129,269,134 F63Y probably benign Het
Osbp2 T C 11: 3,717,944 K18E probably damaging Het
Pcdh8 A T 14: 79,771,103 W7R probably benign Het
Pcsk7 G T 9: 45,927,673 probably null Het
Plin4 G A 17: 56,104,883 T716I probably damaging Het
Prkcb G A 7: 122,568,134 V356I probably damaging Het
Pus7 G A 5: 23,760,246 T304I probably damaging Het
Rmnd1 A G 10: 4,403,989 V402A probably damaging Het
Slmap T C 14: 26,460,191 E329G probably damaging Het
Sytl3 T C 17: 6,681,947 probably benign Het
Tg A G 15: 66,689,927 I1087V probably benign Het
Tmco1 A G 1: 167,326,003 T162A Het
Tti1 G A 2: 158,007,996 T441I probably benign Het
Tubgcp6 G T 15: 89,102,323 Q1366K possibly damaging Het
Ush1g T C 11: 115,318,573 K265R probably benign Het
Zdhhc8 A G 16: 18,227,810 V209A probably damaging Het
Zfp423 A T 8: 87,688,067 C1208S possibly damaging Het
Zfyve26 A T 12: 79,268,676 V1342E probably damaging Het
Zmym1 A T 4: 127,048,757 C613S probably benign Het
Other mutations in Zfp160
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00714:Zfp160 APN 17 21026702 missense probably benign
IGL01019:Zfp160 APN 17 21020826 missense possibly damaging 0.68
IGL02430:Zfp160 APN 17 21025530 missense possibly damaging 0.76
R0412:Zfp160 UTSW 17 21026877 missense probably damaging 0.97
R0600:Zfp160 UTSW 17 21027006 missense probably benign 0.00
R2146:Zfp160 UTSW 17 21026982 missense probably benign 0.13
R2157:Zfp160 UTSW 17 21020828 missense probably benign 0.23
R2411:Zfp160 UTSW 17 21025745 missense possibly damaging 0.94
R2904:Zfp160 UTSW 17 21025649 missense probably benign 0.00
R4249:Zfp160 UTSW 17 21025738 missense probably benign 0.11
R4896:Zfp160 UTSW 17 21020081 missense probably benign 0.00
R5106:Zfp160 UTSW 17 21026761 missense probably damaging 0.99
R5342:Zfp160 UTSW 17 21020733 missense possibly damaging 0.95
R5352:Zfp160 UTSW 17 21026852 missense probably benign 0.02
R6193:Zfp160 UTSW 17 21026862 missense probably benign 0.24
R6230:Zfp160 UTSW 17 21026445 missense probably benign 0.38
R6753:Zfp160 UTSW 17 21020734 missense probably benign 0.02
R6928:Zfp160 UTSW 17 21041462 missense probably benign 0.04
R7040:Zfp160 UTSW 17 21026532 missense probably damaging 1.00
R7255:Zfp160 UTSW 17 21025487 missense probably benign 0.18
R7497:Zfp160 UTSW 17 21026193 missense probably benign 0.08
R7510:Zfp160 UTSW 17 21026393 missense probably benign 0.00
R7627:Zfp160 UTSW 17 21027008 missense probably damaging 0.99
R7968:Zfp160 UTSW 17 21032729 intron probably null
Z1177:Zfp160 UTSW 17 21026890 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTAATGAAGCTAAGTCCATCAGC -3'
(R):5'- TCTCACCAGTATGGATTCTTCGATG -3'

Sequencing Primer
(F):5'- AAGTCCATCAGCAGTGGTTC -3'
(R):5'- CGATGACTCTTAAGGTGTGAATTC -3'
Posted On2019-10-17