Mutagenetix > Incidental Mutation

Incidental Mutation 'R7541:Fbxo18'

583870

Institutional Source

Beutler Lab

Gene Symbol

Fbxo18

Ensembl Gene

ENSMUSG00000058594

Gene Name

F-box protein 18

Synonyms

Fbx18

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.383) question?

Stock #

R7541 (G1)

Quality Score

204.009

Status

Validated

Chromosome

Chromosomal Location

11742573-11777582 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 11749537 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glycine at position 797 (R797G)

Ref Sequence

ENSEMBL: ENSMUSP00000071495 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071564] [ENSMUST00000131893]

AlphaFold

Q8K2I9

Predicted Effect

probably benign
Transcript: ENSMUST00000071564
AA Change: R797G

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000071495
Gene: ENSMUSG00000058594
AA Change: R797G

Domain	Start	End	E-Value	Type
FBOX	213	256	3.94e-3	SMART
Pfam:UvrD-helicase	626	692	8e-10	PFAM
Pfam:UvrD_C	862	935	1.7e-12	PFAM
Pfam:UvrD_C_2	867	931	1.6e-12	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000131893
AA Change: R212G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000116392
Gene: ENSMUSG00000058594
AA Change: R212G

Domain	Start	End	E-Value	Type
SCOP:d1pjr_1	63	141	5e-9	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

96% (51/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family, members of which are characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into three classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbx class. It contains an F-box motif and seven conserved helicase motifs, and has both DNA-dependent ATPase and DNA unwinding activities. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700020D05Rik	G	A	19: 5,503,411	P114L	probably benign	Het
4930539E08Rik	G	A	17: 28,905,324	R335W	probably damaging	Het
9530053A07Rik	T	A	7: 28,144,256	C856*	probably null	Het
Acss2	G	A	2: 155,574,690		probably null	Het
Adamts10	G	A	17: 33,531,616	R210H	probably benign	Het
Als2	T	C	1: 59,167,616		probably null	Het
Aplp2	A	T	9: 31,152,356	M652K	possibly damaging	Het
Atrn	A	G	2: 130,961,571	I560M	possibly damaging	Het
Bicc1	T	C	10: 70,946,604	D602G	possibly damaging	Het
Cdh4	A	G	2: 179,444,810		probably null	Het
Clasp1	T	A	1: 118,542,997		probably null	Het
Col6a6	A	G	9: 105,767,324	I1255T	probably damaging	Het
Comp	G	T	8: 70,381,350	V672L	probably damaging	Het
Dbnl	T	G	11: 5,795,486	D122E	probably damaging	Het
Dgkz	G	A	2: 91,942,675	R346C	probably damaging	Het
Dnhd1	C	T	7: 105,678,309	R54C	probably damaging	Het
Elmo3	T	C	8: 105,306,714	I121T	probably damaging	Het
Fam184b	A	G	5: 45,542,232	L614P	probably damaging	Het
Gata6	A	G	18: 11,059,108	T392A	probably damaging	Het
Gm17783	T	A	16: 45,528,492	T106S	possibly damaging	Het
Gm21731	A	T	13: 120,240,979	M104L	probably benign	Het
Gm29609	A	G	5: 31,154,232	F855S	probably benign	Het
Gm3424	T	C	14: 5,829,330	N88D	possibly damaging	Het
Gnas	T	A	2: 174,298,099	S80T	unknown	Het
Hsd17b14	C	A	7: 45,566,146	P190Q	probably damaging	Het
Iqch	C	T	9: 63,445,521	V955I	possibly damaging	Het
Kcnt2	T	C	1: 140,376,384	V164A	probably benign	Het
Krt87	A	G	15: 101,438,634	L46P	probably damaging	Het
Lef1	A	G	3: 131,191,099	M237V	probably benign	Het
Lmbr1l	A	T	15: 98,909,386		probably null	Het
Lrrc49	T	C	9: 60,610,403	I408V	probably damaging	Het
Luc7l3	T	C	11: 94,295,965	S365G	unknown	Het
March2	A	T	17: 33,703,058	C109*	probably null	Het
Metrnl	T	A	11: 121,715,970	C284S	probably damaging	Het
Mmachc	G	A	4: 116,705,885	T91I	probably benign	Het
Mrps7	T	G	11: 115,606,870	M187R	probably damaging	Het
Ncapd3	A	G	9: 27,067,040	E845G	probably damaging	Het
Olfr1393	T	A	11: 49,280,333	F62I	probably damaging	Het
Olfr272	A	T	4: 52,911,376	D139E	probably benign	Het
Ooep	T	A	9: 78,378,065	T90S	possibly damaging	Het
Pcdhb18	A	T	18: 37,491,609	D664V	probably damaging	Het
Pigz	T	C	16: 31,945,131	S336P	probably benign	Het
Pou2f2	A	T	7: 25,116,128	D71E	probably benign	Het
Reep6	G	T	10: 80,335,199	R303L	possibly damaging	Het
Rmdn2	A	T	17: 79,627,868	S137C		Het
Rnf220	A	T	4: 117,489,930	L95H	probably damaging	Het
Rsf1	CGGCGGCGG	CGGCGGCGGGGGCGGCGG	7: 97,579,911		probably benign	Het
Stxbp1	A	T	2: 32,818,505	S83T	probably damaging	Het
Trappc11	T	C	8: 47,505,582		probably null	Het
Ttn	G	T	2: 76,791,301	D15598E	probably damaging	Het
Vav2	T	A	2: 27,275,002	R645W	probably damaging	Het
Vmn1r169	T	A	7: 23,577,987	V268D	probably benign	Het
Zp2	A	T	7: 120,136,056	C365S	probably damaging	Het

Other mutations in Fbxo18

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01615:Fbxo18	APN	2	11757523	nonsense	probably null
IGL02081:Fbxo18	APN	2	11764127	missense	probably benign	0.31
IGL02082:Fbxo18	APN	2	11764127	missense	probably benign	0.31
IGL02084:Fbxo18	APN	2	11764127	missense	probably benign	0.31
IGL02086:Fbxo18	APN	2	11764127	missense	probably benign	0.31
IGL02369:Fbxo18	APN	2	11747158	missense	possibly damaging	0.61
IGL02584:Fbxo18	APN	2	11759958	missense	probably benign	0.07
IGL03138:Fbxo18	UTSW	2	11749509	intron	probably benign
R0384:Fbxo18	UTSW	2	11749578	missense	probably damaging	1.00
R0479:Fbxo18	UTSW	2	11758419	missense	probably damaging	1.00
R0972:Fbxo18	UTSW	2	11764088	splice site	probably benign
R1420:Fbxo18	UTSW	2	11767682	missense	probably benign	0.01
R1827:Fbxo18	UTSW	2	11763888	missense	possibly damaging	0.88
R1832:Fbxo18	UTSW	2	11767400	missense	probably benign	0.08
R1960:Fbxo18	UTSW	2	11757528	missense	probably damaging	0.98
R2040:Fbxo18	UTSW	2	11769895	missense	possibly damaging	0.66
R2044:Fbxo18	UTSW	2	11762970	missense	possibly damaging	0.89
R2102:Fbxo18	UTSW	2	11758289	missense	probably benign	0.18
R3236:Fbxo18	UTSW	2	11769826	missense	probably damaging	1.00
R3975:Fbxo18	UTSW	2	11767210	missense	possibly damaging	0.72
R4504:Fbxo18	UTSW	2	11749017	missense	possibly damaging	0.91
R4505:Fbxo18	UTSW	2	11749017	missense	possibly damaging	0.91
R4507:Fbxo18	UTSW	2	11749017	missense	possibly damaging	0.91
R4799:Fbxo18	UTSW	2	11755747	missense	probably damaging	1.00
R4894:Fbxo18	UTSW	2	11762960	missense	probably damaging	1.00
R4994:Fbxo18	UTSW	2	11764230	missense	probably damaging	1.00
R5579:Fbxo18	UTSW	2	11748993	missense	probably damaging	0.97
R5801:Fbxo18	UTSW	2	11769826	missense	probably damaging	1.00
R6255:Fbxo18	UTSW	2	11748446	missense	probably benign	0.31
R7011:Fbxo18	UTSW	2	11762963	missense	probably damaging	1.00
R7177:Fbxo18	UTSW	2	11755711	missense	probably damaging	1.00
R7243:Fbxo18	UTSW	2	11751525	missense	probably benign	0.11
R7331:Fbxo18	UTSW	2	11763986	missense	probably benign
R7361:Fbxo18	UTSW	2	11747076	missense	probably damaging	1.00
R7460:Fbxo18	UTSW	2	11756685	missense	probably benign	0.38
R8000:Fbxo18	UTSW	2	11767289	missense	probably benign	0.21
R8010:Fbxo18	UTSW	2	11767632	missense	probably benign	0.15
R8056:Fbxo18	UTSW	2	11743630	missense	probably benign	0.01
R8517:Fbxo18	UTSW	2	11777430	critical splice donor site	probably null
R8686:Fbxo18	UTSW	2	11755658	missense	probably benign	0.00
R8883:Fbxo18	UTSW	2	11749111	missense	probably benign	0.21
R9093:Fbxo18	UTSW	2	11759990	missense	probably damaging	1.00
R9306:Fbxo18	UTSW	2	11767576	missense	probably benign	0.00
R9342:Fbxo18	UTSW	2	11749603	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GGCAACTAATGAGACCACCG -3'
(R):5'- TGATGACAGAGCTGCACAG -3'

Sequencing Primer
(F):5'- CAACTAATGAGACCACCGAGGAG -3'
(R):5'- CCTTTCTGAAGCACGGGGTAGAG -3'

Posted On

2019-10-17