Incidental Mutation 'R7541:Vav2'
ID583871
Institutional Source Beutler Lab
Gene Symbol Vav2
Ensembl Gene ENSMUSG00000009621
Gene Namevav 2 oncogene
Synonyms2810040F13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.291) question?
Stock #R7541 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location27262104-27427033 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 27275002 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 645 (R645W)
Ref Sequence ENSEMBL: ENSMUSP00000062782 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056176] [ENSMUST00000185188]
Predicted Effect probably damaging
Transcript: ENSMUST00000056176
AA Change: R645W

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000062782
Gene: ENSMUSG00000009621
AA Change: R645W

DomainStartEndE-ValueType
CH 3 115 1.87e-24 SMART
low complexity region 165 176 N/A INTRINSIC
RhoGEF 197 370 2.41e-57 SMART
PH 401 504 2.05e-10 SMART
C1 514 562 1.43e-11 SMART
SH3 579 641 1.26e-13 SMART
SH2 661 743 3.37e-25 SMART
low complexity region 759 777 N/A INTRINSIC
SH3 809 866 3.27e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000185188
AA Change: R616W

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000138964
Gene: ENSMUSG00000009621
AA Change: R616W

DomainStartEndE-ValueType
CH 3 129 3.71e-2 SMART
RhoGEF 163 336 2.41e-57 SMART
PH 367 475 1.78e-10 SMART
C1 485 533 1.43e-11 SMART
SH3 550 612 1.26e-13 SMART
SH2 632 714 1.26e-15 SMART
low complexity region 771 789 N/A INTRINSIC
Meta Mutation Damage Score 0.1301 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 96% (51/53)
MGI Phenotype FUNCTION: This gene encodes a member of the Vav family of Rho guanine nucleotide exchange factors. Vav family proteins are involved in the development and activation of lymphocytes, and the encoded protein may also be involved in angiogenesis. Disruption of this gene in mice is associated with heart, artery, and kidney defects, as well as tachycardia and hypertension. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous null mutants have defects in humoral immune response to type II thymus-independent antigens, in primary response to thymus-dependent antigens and inability to switch immunoglobulin class, form germinal centers and generate secondary responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik G A 19: 5,503,411 P114L probably benign Het
4930539E08Rik G A 17: 28,905,324 R335W probably damaging Het
9530053A07Rik T A 7: 28,144,256 C856* probably null Het
Acss2 G A 2: 155,574,690 probably null Het
Adamts10 G A 17: 33,531,616 R210H probably benign Het
Als2 T C 1: 59,167,616 probably null Het
Aplp2 A T 9: 31,152,356 M652K possibly damaging Het
Atrn A G 2: 130,961,571 I560M possibly damaging Het
Bicc1 T C 10: 70,946,604 D602G possibly damaging Het
Cdh4 A G 2: 179,444,810 probably null Het
Clasp1 T A 1: 118,542,997 probably null Het
Col6a6 A G 9: 105,767,324 I1255T probably damaging Het
Comp G T 8: 70,381,350 V672L probably damaging Het
Dbnl T G 11: 5,795,486 D122E probably damaging Het
Dgkz G A 2: 91,942,675 R346C probably damaging Het
Dnhd1 C T 7: 105,678,309 R54C probably damaging Het
Elmo3 T C 8: 105,306,714 I121T probably damaging Het
Fam184b A G 5: 45,542,232 L614P probably damaging Het
Fbxo18 T C 2: 11,749,537 R797G probably benign Het
Gata6 A G 18: 11,059,108 T392A probably damaging Het
Gm17783 T A 16: 45,528,492 T106S possibly damaging Het
Gm21731 A T 13: 120,240,979 M104L probably benign Het
Gm29609 A G 5: 31,154,232 F855S probably benign Het
Gm3424 T C 14: 5,829,330 N88D possibly damaging Het
Gnas T A 2: 174,298,099 S80T unknown Het
Hsd17b14 C A 7: 45,566,146 P190Q probably damaging Het
Iqch C T 9: 63,445,521 V955I possibly damaging Het
Kcnt2 T C 1: 140,376,384 V164A probably benign Het
Krt87 A G 15: 101,438,634 L46P probably damaging Het
Lef1 A G 3: 131,191,099 M237V probably benign Het
Lmbr1l A T 15: 98,909,386 probably null Het
Lrrc49 T C 9: 60,610,403 I408V probably damaging Het
Luc7l3 T C 11: 94,295,965 S365G unknown Het
March2 A T 17: 33,703,058 C109* probably null Het
Metrnl T A 11: 121,715,970 C284S probably damaging Het
Mmachc G A 4: 116,705,885 T91I probably benign Het
Mrps7 T G 11: 115,606,870 M187R probably damaging Het
Ncapd3 A G 9: 27,067,040 E845G probably damaging Het
Olfr1393 T A 11: 49,280,333 F62I probably damaging Het
Olfr272 A T 4: 52,911,376 D139E probably benign Het
Ooep T A 9: 78,378,065 T90S possibly damaging Het
Pcdhb18 A T 18: 37,491,609 D664V probably damaging Het
Pigz T C 16: 31,945,131 S336P probably benign Het
Pou2f2 A T 7: 25,116,128 D71E probably benign Het
Reep6 G T 10: 80,335,199 R303L possibly damaging Het
Rmdn2 A T 17: 79,627,868 S137C Het
Rnf220 A T 4: 117,489,930 L95H probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,911 probably benign Het
Stxbp1 A T 2: 32,818,505 S83T probably damaging Het
Trappc11 T C 8: 47,505,582 probably null Het
Ttn G T 2: 76,791,301 D15598E probably damaging Het
Vmn1r169 T A 7: 23,577,987 V268D probably benign Het
Zp2 A T 7: 120,136,056 C365S probably damaging Het
Other mutations in Vav2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Vav2 APN 2 27277238 missense probably benign 0.35
IGL02394:Vav2 APN 2 27297659 splice site probably benign
IGL03088:Vav2 APN 2 27267250 missense possibly damaging 0.74
IGL03256:Vav2 APN 2 27271900 splice site probably null
IGL03295:Vav2 APN 2 27275029 missense possibly damaging 0.90
Assent UTSW 2 27296219 missense probably damaging 1.00
R0097:Vav2 UTSW 2 27299362 splice site probably benign
R0097:Vav2 UTSW 2 27299362 splice site probably benign
R0140:Vav2 UTSW 2 27273676 splice site probably benign
R0331:Vav2 UTSW 2 27296175 missense probably benign 0.09
R0619:Vav2 UTSW 2 27296121 critical splice donor site probably null
R1191:Vav2 UTSW 2 27292780 splice site probably null
R1723:Vav2 UTSW 2 27318964 missense possibly damaging 0.94
R2107:Vav2 UTSW 2 27267303 missense probably damaging 1.00
R2131:Vav2 UTSW 2 27299396 missense possibly damaging 0.71
R2164:Vav2 UTSW 2 27273706 missense probably damaging 0.96
R2268:Vav2 UTSW 2 27292655 splice site probably null
R2927:Vav2 UTSW 2 27426391 missense probably damaging 1.00
R3802:Vav2 UTSW 2 27267223 splice site probably benign
R4050:Vav2 UTSW 2 27288679 missense probably benign 0.01
R4050:Vav2 UTSW 2 27291403 missense probably damaging 1.00
R4626:Vav2 UTSW 2 27270160 missense possibly damaging 0.62
R4895:Vav2 UTSW 2 27318961 missense probably damaging 0.99
R5441:Vav2 UTSW 2 27270110 intron probably benign
R6009:Vav2 UTSW 2 27271900 splice site probably null
R6501:Vav2 UTSW 2 27296219 missense probably damaging 1.00
R6564:Vav2 UTSW 2 27279185 splice site probably null
R7206:Vav2 UTSW 2 27336719 missense probably benign 0.17
R7267:Vav2 UTSW 2 27283322 missense probably damaging 0.99
R7691:Vav2 UTSW 2 27297738 critical splice acceptor site probably null
R7786:Vav2 UTSW 2 27386601 missense probably damaging 1.00
R7822:Vav2 UTSW 2 27282287 critical splice donor site probably null
R8434:Vav2 UTSW 2 27269038 intron probably benign
R8535:Vav2 UTSW 2 27271829 missense probably damaging 1.00
X0064:Vav2 UTSW 2 27282351 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGGTTCTACATTAGCTTCCACTG -3'
(R):5'- AGGTCAACTAAGGTCCCAGC -3'

Sequencing Primer
(F):5'- TTCAGATCAGGACGTAGCTCTCAG -3'
(R):5'- GTCAACTAAGGTCCCAGCAGAAAG -3'
Posted On2019-10-17