Incidental Mutation 'R7541:Acss2'
ID 583876
Institutional Source Beutler Lab
Gene Symbol Acss2
Ensembl Gene ENSMUSG00000027605
Gene Name acyl-CoA synthetase short-chain family member 2
Synonyms Acas1, acetyl-CoA synthetase 1, Acas2, AceCS1, ACAS, Acs1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.307) question?
Stock # R7541 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 155517948-155585724 bp(+) (GRCm38)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 155574690 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000068776 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065973] [ENSMUST00000079691] [ENSMUST00000126322] [ENSMUST00000130881] [ENSMUST00000155347]
AlphaFold Q9QXG4
Predicted Effect probably null
Transcript: ENSMUST00000065973
SMART Domains Protein: ENSMUSP00000068776
Gene: ENSMUSG00000027605

DomainStartEndE-ValueType
Pfam:AMP-binding 108 575 4.8e-98 PFAM
Pfam:AMP-binding_C 583 660 3.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079691
SMART Domains Protein: ENSMUSP00000078630
Gene: ENSMUSG00000027610

DomainStartEndE-ValueType
Pfam:GSH_synth_ATP 12 472 6.7e-131 PFAM
Pfam:GSH_synthase 204 302 2.5e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126322
SMART Domains Protein: ENSMUSP00000117266
Gene: ENSMUSG00000027610

DomainStartEndE-ValueType
Pfam:GSH_synth_ATP 1 197 1.2e-63 PFAM
Pfam:GSH_synthase 160 200 3.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130881
SMART Domains Protein: ENSMUSP00000135319
Gene: ENSMUSG00000027610

DomainStartEndE-ValueType
Pfam:GSH_synth_ATP 1 404 9.2e-130 PFAM
Pfam:GSH_synthase 133 233 9e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155347
SMART Domains Protein: ENSMUSP00000122662
Gene: ENSMUSG00000027610

DomainStartEndE-ValueType
Pfam:GSH_synth_ATP 5 179 1.8e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175993
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 96% (51/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytosolic enzyme that catalyzes the activation of acetate for use in lipid synthesis and energy generation. The protein acts as a monomer and produces acetyl-CoA from acetate in a reaction that requires ATP. Expression of this gene is regulated by sterol regulatory element-binding proteins, transcription factors that activate genes required for the synthesis of cholesterol and unsaturated fatty acids. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2009]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik G A 19: 5,503,411 P114L probably benign Het
4930539E08Rik G A 17: 28,905,324 R335W probably damaging Het
9530053A07Rik T A 7: 28,144,256 C856* probably null Het
Adamts10 G A 17: 33,531,616 R210H probably benign Het
Als2 T C 1: 59,167,616 probably null Het
Aplp2 A T 9: 31,152,356 M652K possibly damaging Het
Atrn A G 2: 130,961,571 I560M possibly damaging Het
Bicc1 T C 10: 70,946,604 D602G possibly damaging Het
Cdh4 A G 2: 179,444,810 probably null Het
Clasp1 T A 1: 118,542,997 probably null Het
Col6a6 A G 9: 105,767,324 I1255T probably damaging Het
Comp G T 8: 70,381,350 V672L probably damaging Het
Dbnl T G 11: 5,795,486 D122E probably damaging Het
Dgkz G A 2: 91,942,675 R346C probably damaging Het
Dnhd1 C T 7: 105,678,309 R54C probably damaging Het
Elmo3 T C 8: 105,306,714 I121T probably damaging Het
Fam184b A G 5: 45,542,232 L614P probably damaging Het
Fbxo18 T C 2: 11,749,537 R797G probably benign Het
Gata6 A G 18: 11,059,108 T392A probably damaging Het
Gm17783 T A 16: 45,528,492 T106S possibly damaging Het
Gm21731 A T 13: 120,240,979 M104L probably benign Het
Gm29609 A G 5: 31,154,232 F855S probably benign Het
Gm3424 T C 14: 5,829,330 N88D possibly damaging Het
Gnas T A 2: 174,298,099 S80T unknown Het
Hsd17b14 C A 7: 45,566,146 P190Q probably damaging Het
Iqch C T 9: 63,445,521 V955I possibly damaging Het
Kcnt2 T C 1: 140,376,384 V164A probably benign Het
Krt87 A G 15: 101,438,634 L46P probably damaging Het
Lef1 A G 3: 131,191,099 M237V probably benign Het
Lmbr1l A T 15: 98,909,386 probably null Het
Lrrc49 T C 9: 60,610,403 I408V probably damaging Het
Luc7l3 T C 11: 94,295,965 S365G unknown Het
March2 A T 17: 33,703,058 C109* probably null Het
Metrnl T A 11: 121,715,970 C284S probably damaging Het
Mmachc G A 4: 116,705,885 T91I probably benign Het
Mrps7 T G 11: 115,606,870 M187R probably damaging Het
Ncapd3 A G 9: 27,067,040 E845G probably damaging Het
Olfr1393 T A 11: 49,280,333 F62I probably damaging Het
Olfr272 A T 4: 52,911,376 D139E probably benign Het
Ooep T A 9: 78,378,065 T90S possibly damaging Het
Pcdhb18 A T 18: 37,491,609 D664V probably damaging Het
Pigz T C 16: 31,945,131 S336P probably benign Het
Pou2f2 A T 7: 25,116,128 D71E probably benign Het
Reep6 G T 10: 80,335,199 R303L possibly damaging Het
Rmdn2 A T 17: 79,627,868 S137C Het
Rnf220 A T 4: 117,489,930 L95H probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,911 probably benign Het
Stxbp1 A T 2: 32,818,505 S83T probably damaging Het
Trappc11 T C 8: 47,505,582 probably null Het
Ttn G T 2: 76,791,301 D15598E probably damaging Het
Vav2 T A 2: 27,275,002 R645W probably damaging Het
Vmn1r169 T A 7: 23,577,987 V268D probably benign Het
Zp2 A T 7: 120,136,056 C365S probably damaging Het
Other mutations in Acss2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01146:Acss2 APN 2 155562037 missense possibly damaging 0.83
IGL02333:Acss2 APN 2 155555884 missense probably damaging 1.00
IGL03278:Acss2 APN 2 155562001 missense possibly damaging 0.64
IGL03392:Acss2 APN 2 155562011 missense probably damaging 1.00
BB009:Acss2 UTSW 2 155573180 missense unknown
BB019:Acss2 UTSW 2 155573180 missense unknown
R1159:Acss2 UTSW 2 155551218 missense probably benign
R1293:Acss2 UTSW 2 155551221 missense probably benign
R1639:Acss2 UTSW 2 155556908 missense probably benign 0.01
R1725:Acss2 UTSW 2 155556844 missense possibly damaging 0.56
R1834:Acss2 UTSW 2 155558630 missense probably damaging 1.00
R1835:Acss2 UTSW 2 155558630 missense probably damaging 1.00
R1836:Acss2 UTSW 2 155558630 missense probably damaging 1.00
R2361:Acss2 UTSW 2 155558669 missense probably damaging 0.98
R3899:Acss2 UTSW 2 155557237 splice site probably benign
R4008:Acss2 UTSW 2 155557628 missense probably damaging 1.00
R4009:Acss2 UTSW 2 155557628 missense probably damaging 1.00
R4010:Acss2 UTSW 2 155557628 missense probably damaging 1.00
R4011:Acss2 UTSW 2 155557628 missense probably damaging 1.00
R4031:Acss2 UTSW 2 155557210 missense probably damaging 1.00
R4117:Acss2 UTSW 2 155556393 missense probably damaging 1.00
R4515:Acss2 UTSW 2 155556363 missense probably benign 0.39
R4756:Acss2 UTSW 2 155561143 missense probably damaging 1.00
R4895:Acss2 UTSW 2 155550481 splice site probably benign
R5327:Acss2 UTSW 2 155573229 missense probably null
R5654:Acss2 UTSW 2 155574655 unclassified probably benign
R5717:Acss2 UTSW 2 155561153 missense probably damaging 1.00
R5743:Acss2 UTSW 2 155574616 unclassified probably benign
R5773:Acss2 UTSW 2 155574694 splice site probably null
R5825:Acss2 UTSW 2 155549178 splice site probably null
R5979:Acss2 UTSW 2 155522109 missense possibly damaging 0.75
R6525:Acss2 UTSW 2 155550417 missense probably benign
R6551:Acss2 UTSW 2 155551208 missense probably benign
R6785:Acss2 UTSW 2 155560685 missense probably damaging 1.00
R6976:Acss2 UTSW 2 155556009 splice site probably null
R7074:Acss2 UTSW 2 155522041 missense possibly damaging 0.94
R7372:Acss2 UTSW 2 155557180 missense probably damaging 0.99
R7448:Acss2 UTSW 2 155518266 missense probably damaging 1.00
R7528:Acss2 UTSW 2 155557146 missense probably damaging 1.00
R7543:Acss2 UTSW 2 155549835 missense probably damaging 0.98
R7754:Acss2 UTSW 2 155561166 missense probably benign 0.00
R7846:Acss2 UTSW 2 155561033 missense probably damaging 1.00
R7932:Acss2 UTSW 2 155573180 missense unknown
R8011:Acss2 UTSW 2 155555957 missense possibly damaging 0.73
R8424:Acss2 UTSW 2 155574618 missense unknown
R8481:Acss2 UTSW 2 155556461 nonsense probably null
R8878:Acss2 UTSW 2 155556404 missense probably benign 0.20
R8956:Acss2 UTSW 2 155549518 missense probably damaging 1.00
R9463:Acss2 UTSW 2 155550112 missense probably benign 0.23
R9545:Acss2 UTSW 2 155561796 missense probably damaging 1.00
Z1177:Acss2 UTSW 2 155517957 intron probably benign
Predicted Primers PCR Primer
(F):5'- CCAGACATTGGCTTTGTATGC -3'
(R):5'- TGAGCCAGAGTCTGCAATTC -3'

Sequencing Primer
(F):5'- GGCTTTGTATGCTAATTATTTCTCAC -3'
(R):5'- ATTTTAACCGCCAGCCTGCAG -3'
Posted On 2019-10-17