Incidental Mutation 'R7541:Lef1'
ID583878
Institutional Source Beutler Lab
Gene Symbol Lef1
Ensembl Gene ENSMUSG00000027985
Gene Namelymphoid enhancer binding factor 1
Synonymslymphoid enhancer factor 1, Lef-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7541 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location131110471-131224356 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 131191099 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 237 (M237V)
Ref Sequence ENSEMBL: ENSMUSP00000029611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029611] [ENSMUST00000066849] [ENSMUST00000098611] [ENSMUST00000106341]
PDB Structure LEF1 HMG DOMAIN (FROM MOUSE), COMPLEXED WITH DNA (15BP), NMR, 12 STRUCTURES [SOLUTION NMR]
Structure of beta-catenin with Lef-1 [X-RAY DIFFRACTION]
Structure of beta-catenin with phosphorylated Lef-1 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000029611
AA Change: M237V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000029611
Gene: ENSMUSG00000027985
AA Change: M237V

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 211 5e-88 PFAM
low complexity region 245 259 N/A INTRINSIC
HMG 296 366 7.68e-23 SMART
low complexity region 372 380 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000066849
SMART Domains Protein: ENSMUSP00000067808
Gene: ENSMUSG00000027985

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 211 1e-75 PFAM
low complexity region 217 231 N/A INTRINSIC
HMG 268 338 7.68e-23 SMART
low complexity region 344 352 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098611
AA Change: M171V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000096211
Gene: ENSMUSG00000027985
AA Change: M171V

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 145 2.8e-54 PFAM
low complexity region 179 193 N/A INTRINSIC
HMG 230 300 7.68e-23 SMART
low complexity region 306 314 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106341
SMART Domains Protein: ENSMUSP00000101948
Gene: ENSMUSG00000027985

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 211 1.3e-75 PFAM
low complexity region 217 231 N/A INTRINSIC
HMG 268 338 7.68e-23 SMART
low complexity region 344 352 N/A INTRINSIC
Meta Mutation Damage Score 0.0830 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 96% (51/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor belonging to a family of proteins that share homology with the high mobility group protein-1. The protein encoded by this gene can bind to a functionally important site in the T-cell receptor-alpha enhancer, thereby conferring maximal enhancer activity. This transcription factor is involved in the Wnt signaling pathway, and it may function in hair cell differentiation and follicle morphogenesis. Mutations in this gene have been found in somatic sebaceous tumors. This gene has also been linked to other cancers, including androgen-independent prostate cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a null allele are small and die postnatally showing lack of teeth, mammary and uterine glands, whiskers, body hair, dermal-associated fat, and a dentate gyrus, as well as defects in hippocampus morphology, hair follicle development, retinal vasculature, and vascular regression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik G A 19: 5,503,411 P114L probably benign Het
4930539E08Rik G A 17: 28,905,324 R335W probably damaging Het
9530053A07Rik T A 7: 28,144,256 C856* probably null Het
Acss2 G A 2: 155,574,690 probably null Het
Adamts10 G A 17: 33,531,616 R210H probably benign Het
Als2 T C 1: 59,167,616 probably null Het
Aplp2 A T 9: 31,152,356 M652K possibly damaging Het
Atrn A G 2: 130,961,571 I560M possibly damaging Het
Bicc1 T C 10: 70,946,604 D602G possibly damaging Het
Cdh4 A G 2: 179,444,810 probably null Het
Clasp1 T A 1: 118,542,997 probably null Het
Col6a6 A G 9: 105,767,324 I1255T probably damaging Het
Comp G T 8: 70,381,350 V672L probably damaging Het
Dbnl T G 11: 5,795,486 D122E probably damaging Het
Dgkz G A 2: 91,942,675 R346C probably damaging Het
Dnhd1 C T 7: 105,678,309 R54C probably damaging Het
Elmo3 T C 8: 105,306,714 I121T probably damaging Het
Fam184b A G 5: 45,542,232 L614P probably damaging Het
Fbxo18 T C 2: 11,749,537 R797G probably benign Het
Gata6 A G 18: 11,059,108 T392A probably damaging Het
Gm17783 T A 16: 45,528,492 T106S possibly damaging Het
Gm21731 A T 13: 120,240,979 M104L probably benign Het
Gm29609 A G 5: 31,154,232 F855S probably benign Het
Gm3424 T C 14: 5,829,330 N88D possibly damaging Het
Gnas T A 2: 174,298,099 S80T unknown Het
Hsd17b14 C A 7: 45,566,146 P190Q probably damaging Het
Iqch C T 9: 63,445,521 V955I possibly damaging Het
Kcnt2 T C 1: 140,376,384 V164A probably benign Het
Krt87 A G 15: 101,438,634 L46P probably damaging Het
Lmbr1l A T 15: 98,909,386 probably null Het
Lrrc49 T C 9: 60,610,403 I408V probably damaging Het
Luc7l3 T C 11: 94,295,965 S365G unknown Het
March2 A T 17: 33,703,058 C109* probably null Het
Metrnl T A 11: 121,715,970 C284S probably damaging Het
Mmachc G A 4: 116,705,885 T91I probably benign Het
Mrps7 T G 11: 115,606,870 M187R probably damaging Het
Ncapd3 A G 9: 27,067,040 E845G probably damaging Het
Olfr1393 T A 11: 49,280,333 F62I probably damaging Het
Olfr272 A T 4: 52,911,376 D139E probably benign Het
Ooep T A 9: 78,378,065 T90S possibly damaging Het
Pcdhb18 A T 18: 37,491,609 D664V probably damaging Het
Pigz T C 16: 31,945,131 S336P probably benign Het
Pou2f2 A T 7: 25,116,128 D71E probably benign Het
Reep6 G T 10: 80,335,199 R303L possibly damaging Het
Rmdn2 A T 17: 79,627,868 S137C Het
Rnf220 A T 4: 117,489,930 L95H probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,911 probably benign Het
Stxbp1 A T 2: 32,818,505 S83T probably damaging Het
Trappc11 T C 8: 47,505,582 probably null Het
Ttn G T 2: 76,791,301 D15598E probably damaging Het
Vav2 T A 2: 27,275,002 R645W probably damaging Het
Vmn1r169 T A 7: 23,577,987 V268D probably benign Het
Zp2 A T 7: 120,136,056 C365S probably damaging Het
Other mutations in Lef1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Lef1 APN 3 131113850 splice site probably benign
IGL00515:Lef1 APN 3 131204277 missense probably damaging 1.00
IGL00780:Lef1 APN 3 131193130 missense possibly damaging 0.69
IGL02057:Lef1 APN 3 131200402 nonsense probably null
IGL02556:Lef1 APN 3 131194793 splice site probably null
IGL02804:Lef1 APN 3 131194689 missense probably damaging 1.00
IGL03143:Lef1 APN 3 131200316 nonsense probably null
IGL03169:Lef1 APN 3 131194663 missense probably damaging 1.00
R0470:Lef1 UTSW 3 131112826 intron probably benign
R1354:Lef1 UTSW 3 131194668 missense probably damaging 1.00
R1677:Lef1 UTSW 3 131200289 splice site probably benign
R1860:Lef1 UTSW 3 131111641 missense probably damaging 0.99
R2013:Lef1 UTSW 3 131111587 missense probably damaging 0.98
R2015:Lef1 UTSW 3 131111587 missense probably damaging 0.98
R3440:Lef1 UTSW 3 131184758 missense probably damaging 1.00
R3736:Lef1 UTSW 3 131191066 missense possibly damaging 0.51
R3918:Lef1 UTSW 3 131111641 missense probably damaging 0.99
R4052:Lef1 UTSW 3 131194689 missense probably damaging 1.00
R4346:Lef1 UTSW 3 131194708 missense probably damaging 1.00
R4608:Lef1 UTSW 3 131184733 missense probably benign 0.00
R4764:Lef1 UTSW 3 131184733 missense probably benign 0.00
R4786:Lef1 UTSW 3 131111524 missense probably damaging 0.99
R5298:Lef1 UTSW 3 131194667 missense possibly damaging 0.80
R5394:Lef1 UTSW 3 131194659 missense probably damaging 1.00
R6827:Lef1 UTSW 3 131200404 critical splice donor site probably null
R6893:Lef1 UTSW 3 131115500 missense possibly damaging 0.77
R6974:Lef1 UTSW 3 131111574 missense probably damaging 1.00
R7544:Lef1 UTSW 3 131194765 missense probably damaging 1.00
R7652:Lef1 UTSW 3 131200354 missense probably damaging 1.00
R8074:Lef1 UTSW 3 131204305 critical splice donor site probably null
R8348:Lef1 UTSW 3 131112812 start codon destroyed probably benign 0.02
R8543:Lef1 UTSW 3 131115489 missense possibly damaging 0.92
R8762:Lef1 UTSW 3 131194717 missense probably damaging 1.00
Z1176:Lef1 UTSW 3 131200323 missense probably damaging 1.00
Z1177:Lef1 UTSW 3 131193181 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCAGCCTGTGTTCTGAAC -3'
(R):5'- TCTGGAGTTGCAATGGTTCC -3'

Sequencing Primer
(F):5'- CCAGCCTGTGTTCTGAACTAAGG -3'
(R):5'- CAATGGTTCCTGGTGCCCTG -3'
Posted On2019-10-17