Incidental Mutation 'R7541:Olfr272'
ID 583879
Institutional Source Beutler Lab
Gene Symbol Olfr272
Ensembl Gene ENSMUSG00000051593
Gene Name olfactory receptor 272
Synonyms GA_x6K02T2N78B-7084885-7085844, MOR262-7
MMRRC Submission 045613-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.050) question?
Stock # R7541 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 52910207-52919178 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 52911376 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 139 (D139E)
Ref Sequence ENSEMBL: ENSMUSP00000103294 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051600] [ENSMUST00000107667] [ENSMUST00000213989]
AlphaFold Q8VGA0
Predicted Effect probably benign
Transcript: ENSMUST00000051600
AA Change: D139E

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000055721
Gene: ENSMUSG00000051593
AA Change: D139E

DomainStartEndE-ValueType
Pfam:7tm_4 31 314 1.6e-54 PFAM
Pfam:7tm_1 41 296 9.5e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107667
AA Change: D139E

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000103294
Gene: ENSMUSG00000051593
AA Change: D139E

DomainStartEndE-ValueType
Pfam:7tm_1 39 294 9.5e-33 PFAM
Pfam:7tm_4 138 287 3.3e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213989
AA Change: D139E

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 96% (51/53)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik G A 19: 5,503,411 P114L probably benign Het
4930539E08Rik G A 17: 28,905,324 R335W probably damaging Het
9530053A07Rik T A 7: 28,144,256 C856* probably null Het
Acss2 G A 2: 155,574,690 probably null Het
Adamts10 G A 17: 33,531,616 R210H probably benign Het
Als2 T C 1: 59,167,616 probably null Het
Aplp2 A T 9: 31,152,356 M652K possibly damaging Het
Atrn A G 2: 130,961,571 I560M possibly damaging Het
Bicc1 T C 10: 70,946,604 D602G possibly damaging Het
Cdh4 A G 2: 179,444,810 probably null Het
Clasp1 T A 1: 118,542,997 probably null Het
Col6a6 A G 9: 105,767,324 I1255T probably damaging Het
Comp G T 8: 70,381,350 V672L probably damaging Het
Dbnl T G 11: 5,795,486 D122E probably damaging Het
Dgkz G A 2: 91,942,675 R346C probably damaging Het
Dnhd1 C T 7: 105,678,309 R54C probably damaging Het
Elmo3 T C 8: 105,306,714 I121T probably damaging Het
Fam184b A G 5: 45,542,232 L614P probably damaging Het
Fbxo18 T C 2: 11,749,537 R797G probably benign Het
Gata6 A G 18: 11,059,108 T392A probably damaging Het
Gm17783 T A 16: 45,528,492 T106S possibly damaging Het
Gm21731 A T 13: 120,240,979 M104L probably benign Het
Gm29609 A G 5: 31,154,232 F855S probably benign Het
Gm3424 T C 14: 5,829,330 N88D possibly damaging Het
Gnas T A 2: 174,298,099 S80T unknown Het
Hsd17b14 C A 7: 45,566,146 P190Q probably damaging Het
Iqch C T 9: 63,445,521 V955I possibly damaging Het
Kcnt2 T C 1: 140,376,384 V164A probably benign Het
Krt87 A G 15: 101,438,634 L46P probably damaging Het
Lef1 A G 3: 131,191,099 M237V probably benign Het
Lmbr1l A T 15: 98,909,386 probably null Het
Lrrc49 T C 9: 60,610,403 I408V probably damaging Het
Luc7l3 T C 11: 94,295,965 S365G unknown Het
March2 A T 17: 33,703,058 C109* probably null Het
Metrnl T A 11: 121,715,970 C284S probably damaging Het
Mmachc G A 4: 116,705,885 T91I probably benign Het
Mrps7 T G 11: 115,606,870 M187R probably damaging Het
Ncapd3 A G 9: 27,067,040 E845G probably damaging Het
Olfr1393 T A 11: 49,280,333 F62I probably damaging Het
Ooep T A 9: 78,378,065 T90S possibly damaging Het
Pcdhb18 A T 18: 37,491,609 D664V probably damaging Het
Pigz T C 16: 31,945,131 S336P probably benign Het
Pou2f2 A T 7: 25,116,128 D71E probably benign Het
Reep6 G T 10: 80,335,199 R303L possibly damaging Het
Rmdn2 A T 17: 79,627,868 S137C Het
Rnf220 A T 4: 117,489,930 L95H probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,911 probably benign Het
Stxbp1 A T 2: 32,818,505 S83T probably damaging Het
Trappc11 T C 8: 47,505,582 probably null Het
Ttn G T 2: 76,791,301 D15598E probably damaging Het
Vav2 T A 2: 27,275,002 R645W probably damaging Het
Vmn1r169 T A 7: 23,577,987 V268D probably benign Het
Zp2 A T 7: 120,136,056 C365S probably damaging Het
Other mutations in Olfr272
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Olfr272 APN 4 52911618 missense possibly damaging 0.95
IGL02224:Olfr272 APN 4 52911392 missense probably damaging 0.97
IGL03293:Olfr272 APN 4 52910835 makesense probably null
K3955:Olfr272 UTSW 4 52911081 missense probably damaging 1.00
R0195:Olfr272 UTSW 4 52910849 missense probably benign 0.00
R0197:Olfr272 UTSW 4 52910849 missense probably benign 0.00
R0445:Olfr272 UTSW 4 52910849 missense probably benign 0.00
R1517:Olfr272 UTSW 4 52911502 nonsense probably null
R1536:Olfr272 UTSW 4 52911260 missense probably benign 0.43
R1540:Olfr272 UTSW 4 52910996 missense probably benign 0.00
R1551:Olfr272 UTSW 4 52911397 nonsense probably null
R1612:Olfr272 UTSW 4 52911501 missense probably benign
R1920:Olfr272 UTSW 4 52910849 missense probably benign
R2181:Olfr272 UTSW 4 52911524 missense probably damaging 1.00
R5410:Olfr272 UTSW 4 52910991 missense probably benign 0.01
R6331:Olfr272 UTSW 4 52911399 missense probably damaging 1.00
R6336:Olfr272 UTSW 4 52911459 missense probably damaging 1.00
R7085:Olfr272 UTSW 4 52910961 missense probably benign 0.02
R7727:Olfr272 UTSW 4 52911368 missense possibly damaging 0.89
R7891:Olfr272 UTSW 4 52911663 missense probably benign 0.01
R8782:Olfr272 UTSW 4 52911693 missense probably benign 0.16
R9321:Olfr272 UTSW 4 52911314 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCTGTTAGGCTGATCACG -3'
(R):5'- CCTGGACATCTGCTACACAAG -3'

Sequencing Primer
(F):5'- CGTTGATTGAAATATCTGCACAAGCC -3'
(R):5'- GTCCCCCTAATTCTCAGTAGC -3'
Posted On 2019-10-17