Incidental Mutation 'R7541:Mmachc'
ID583880
Institutional Source Beutler Lab
Gene Symbol Mmachc
Ensembl Gene ENSMUSG00000028690
Gene Namemethylmalonic aciduria cblC type, with homocystinuria
Synonyms1810037K07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.145) question?
Stock #R7541 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location116702279-116708406 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 116705885 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 91 (T91I)
Ref Sequence ENSEMBL: ENSMUSP00000030453 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030452] [ENSMUST00000030453] [ENSMUST00000106462] [ENSMUST00000106463] [ENSMUST00000106464] [ENSMUST00000125671] [ENSMUST00000130828] [ENSMUST00000135499] [ENSMUST00000138305] [ENSMUST00000155391]
Predicted Effect probably benign
Transcript: ENSMUST00000030452
SMART Domains Protein: ENSMUSP00000030452
Gene: ENSMUSG00000028689

DomainStartEndE-ValueType
coiled coil region 112 144 N/A INTRINSIC
coiled coil region 165 196 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000030453
AA Change: T91I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000030453
Gene: ENSMUSG00000028690
AA Change: T91I

DomainStartEndE-ValueType
Pfam:MMACHC 20 234 9.5e-102 PFAM
low complexity region 243 257 N/A INTRINSIC
low complexity region 268 277 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106462
SMART Domains Protein: ENSMUSP00000102070
Gene: ENSMUSG00000028689

DomainStartEndE-ValueType
coiled coil region 21 53 N/A INTRINSIC
coiled coil region 74 105 N/A INTRINSIC
low complexity region 171 186 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106463
SMART Domains Protein: ENSMUSP00000102071
Gene: ENSMUSG00000028689

DomainStartEndE-ValueType
low complexity region 50 60 N/A INTRINSIC
coiled coil region 138 170 N/A INTRINSIC
coiled coil region 191 222 N/A INTRINSIC
low complexity region 288 303 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106464
SMART Domains Protein: ENSMUSP00000102072
Gene: ENSMUSG00000028689

DomainStartEndE-ValueType
low complexity region 50 60 N/A INTRINSIC
coiled coil region 138 170 N/A INTRINSIC
coiled coil region 191 222 N/A INTRINSIC
low complexity region 288 303 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125671
SMART Domains Protein: ENSMUSP00000120954
Gene: ENSMUSG00000028689

DomainStartEndE-ValueType
low complexity region 50 60 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130828
SMART Domains Protein: ENSMUSP00000120572
Gene: ENSMUSG00000028689

DomainStartEndE-ValueType
low complexity region 49 59 N/A INTRINSIC
coiled coil region 137 169 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135499
SMART Domains Protein: ENSMUSP00000114263
Gene: ENSMUSG00000028689

DomainStartEndE-ValueType
low complexity region 63 73 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138305
Predicted Effect probably benign
Transcript: ENSMUST00000155391
SMART Domains Protein: ENSMUSP00000120050
Gene: ENSMUSG00000028689

DomainStartEndE-ValueType
low complexity region 49 59 N/A INTRINSIC
coiled coil region 137 169 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 96% (51/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The exact function of the protein encoded by this gene is not known, however, its C-terminal region shows similarity to TonB, a bacterial protein involved in energy transduction for cobalamin (vitamin B12) uptake. Hence, it is postulated that this protein may have a role in the binding and intracellular trafficking of cobalamin. Mutations in this gene are associated with methylmalonic aciduria and homocystinuria type cblC. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik G A 19: 5,503,411 P114L probably benign Het
4930539E08Rik G A 17: 28,905,324 R335W probably damaging Het
9530053A07Rik T A 7: 28,144,256 C856* probably null Het
Acss2 G A 2: 155,574,690 probably null Het
Adamts10 G A 17: 33,531,616 R210H probably benign Het
Als2 T C 1: 59,167,616 probably null Het
Aplp2 A T 9: 31,152,356 M652K possibly damaging Het
Atrn A G 2: 130,961,571 I560M possibly damaging Het
Bicc1 T C 10: 70,946,604 D602G possibly damaging Het
Cdh4 A G 2: 179,444,810 probably null Het
Clasp1 T A 1: 118,542,997 probably null Het
Col6a6 A G 9: 105,767,324 I1255T probably damaging Het
Comp G T 8: 70,381,350 V672L probably damaging Het
Dbnl T G 11: 5,795,486 D122E probably damaging Het
Dgkz G A 2: 91,942,675 R346C probably damaging Het
Dnhd1 C T 7: 105,678,309 R54C probably damaging Het
Elmo3 T C 8: 105,306,714 I121T probably damaging Het
Fam184b A G 5: 45,542,232 L614P probably damaging Het
Fbxo18 T C 2: 11,749,537 R797G probably benign Het
Gata6 A G 18: 11,059,108 T392A probably damaging Het
Gm17783 T A 16: 45,528,492 T106S possibly damaging Het
Gm21731 A T 13: 120,240,979 M104L probably benign Het
Gm29609 A G 5: 31,154,232 F855S probably benign Het
Gm3424 T C 14: 5,829,330 N88D possibly damaging Het
Gnas T A 2: 174,298,099 S80T unknown Het
Hsd17b14 C A 7: 45,566,146 P190Q probably damaging Het
Iqch C T 9: 63,445,521 V955I possibly damaging Het
Kcnt2 T C 1: 140,376,384 V164A probably benign Het
Krt87 A G 15: 101,438,634 L46P probably damaging Het
Lef1 A G 3: 131,191,099 M237V probably benign Het
Lmbr1l A T 15: 98,909,386 probably null Het
Lrrc49 T C 9: 60,610,403 I408V probably damaging Het
Luc7l3 T C 11: 94,295,965 S365G unknown Het
March2 A T 17: 33,703,058 C109* probably null Het
Metrnl T A 11: 121,715,970 C284S probably damaging Het
Mrps7 T G 11: 115,606,870 M187R probably damaging Het
Ncapd3 A G 9: 27,067,040 E845G probably damaging Het
Olfr1393 T A 11: 49,280,333 F62I probably damaging Het
Olfr272 A T 4: 52,911,376 D139E probably benign Het
Ooep T A 9: 78,378,065 T90S possibly damaging Het
Pcdhb18 A T 18: 37,491,609 D664V probably damaging Het
Pigz T C 16: 31,945,131 S336P probably benign Het
Pou2f2 A T 7: 25,116,128 D71E probably benign Het
Reep6 G T 10: 80,335,199 R303L possibly damaging Het
Rmdn2 A T 17: 79,627,868 S137C Het
Rnf220 A T 4: 117,489,930 L95H probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,911 probably benign Het
Stxbp1 A T 2: 32,818,505 S83T probably damaging Het
Trappc11 T C 8: 47,505,582 probably null Het
Ttn G T 2: 76,791,301 D15598E probably damaging Het
Vav2 T A 2: 27,275,002 R645W probably damaging Het
Vmn1r169 T A 7: 23,577,987 V268D probably benign Het
Zp2 A T 7: 120,136,056 C365S probably damaging Het
Other mutations in Mmachc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00807:Mmachc APN 4 116705921 missense probably damaging 1.00
IGL02014:Mmachc APN 4 116703710 missense probably damaging 1.00
R0242:Mmachc UTSW 4 116704541 missense probably damaging 0.97
R0242:Mmachc UTSW 4 116704541 missense probably damaging 0.97
R0646:Mmachc UTSW 4 116703654 missense probably damaging 1.00
R1413:Mmachc UTSW 4 116705997 missense probably damaging 0.97
R1589:Mmachc UTSW 4 116703524 missense probably benign 0.05
R4037:Mmachc UTSW 4 116706018 missense probably damaging 0.99
R4038:Mmachc UTSW 4 116706018 missense probably damaging 0.99
R4039:Mmachc UTSW 4 116706018 missense probably damaging 0.99
R4627:Mmachc UTSW 4 116703471 missense probably damaging 0.97
R5557:Mmachc UTSW 4 116705900 missense probably damaging 0.96
R6749:Mmachc UTSW 4 116704541 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTGGGTGTAAGAAGTTGC -3'
(R):5'- TACAATGAACTCCTGCCTCCAG -3'

Sequencing Primer
(F):5'- ATGGTGGCTCACAACCATCTG -3'
(R):5'- GAACTCCTGCCTCCAGCCTTC -3'
Posted On2019-10-17