Incidental Mutation 'R7541:Gm29609'
ID 583882
Institutional Source Beutler Lab
Gene Symbol Gm29609
Ensembl Gene ENSMUSG00000101678
Gene Name predicted gene 29609
Synonyms
MMRRC Submission 045613-MU
Accession Numbers
Essential gene? Not available question?
Stock # R7541 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 31302083-31337255 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 31311576 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 855 (F855S)
Ref Sequence ENSEMBL: ENSMUSP00000098957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088010] [ENSMUST00000101411] [ENSMUST00000154241] [ENSMUST00000200744] [ENSMUST00000200833] [ENSMUST00000200864] [ENSMUST00000201353] [ENSMUST00000201491] [ENSMUST00000202241] [ENSMUST00000202639]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000088010
SMART Domains Protein: ENSMUSP00000085325
Gene: ENSMUSG00000106864

DomainStartEndE-ValueType
low complexity region 99 109 N/A INTRINSIC
low complexity region 144 159 N/A INTRINSIC
low complexity region 185 200 N/A INTRINSIC
low complexity region 207 225 N/A INTRINSIC
low complexity region 249 268 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
WD40 452 508 6.39e0 SMART
WD40 530 580 1.6e0 SMART
WD40 598 638 3.37e-6 SMART
WD40 821 861 5.33e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000101411
AA Change: F855S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000098957
Gene: ENSMUSG00000101678
AA Change: F855S

DomainStartEndE-ValueType
low complexity region 99 109 N/A INTRINSIC
low complexity region 144 159 N/A INTRINSIC
low complexity region 185 200 N/A INTRINSIC
low complexity region 207 225 N/A INTRINSIC
low complexity region 249 268 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
WD40 452 508 6.39e0 SMART
WD40 530 580 1.6e0 SMART
WD40 598 638 3.37e-6 SMART
Blast:WD40 807 844 2e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000154241
SMART Domains Protein: ENSMUSP00000115292
Gene: ENSMUSG00000107283

DomainStartEndE-ValueType
transmembrane domain 48 70 N/A INTRINSIC
Pfam:Mpv17_PMP22 108 175 2.2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200744
SMART Domains Protein: ENSMUSP00000143843
Gene: ENSMUSG00000107283

DomainStartEndE-ValueType
transmembrane domain 48 70 N/A INTRINSIC
Pfam:Mpv17_PMP22 103 163 5.7e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200833
SMART Domains Protein: ENSMUSP00000144324
Gene: ENSMUSG00000107283

DomainStartEndE-ValueType
transmembrane domain 48 70 N/A INTRINSIC
transmembrane domain 94 116 N/A INTRINSIC
low complexity region 135 146 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200864
SMART Domains Protein: ENSMUSP00000144331
Gene: ENSMUSG00000107283

DomainStartEndE-ValueType
transmembrane domain 48 70 N/A INTRINSIC
Pfam:Mpv17_PMP22 109 174 1.7e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201353
SMART Domains Protein: ENSMUSP00000144198
Gene: ENSMUSG00000107283

DomainStartEndE-ValueType
transmembrane domain 48 70 N/A INTRINSIC
Pfam:Mpv17_PMP22 109 174 1.7e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201491
SMART Domains Protein: ENSMUSP00000144593
Gene: ENSMUSG00000107283

DomainStartEndE-ValueType
transmembrane domain 48 70 N/A INTRINSIC
Pfam:Mpv17_PMP22 109 155 4.6e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202241
SMART Domains Protein: ENSMUSP00000144119
Gene: ENSMUSG00000107283

DomainStartEndE-ValueType
transmembrane domain 48 70 N/A INTRINSIC
Pfam:Mpv17_PMP22 109 176 4e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202639
SMART Domains Protein: ENSMUSP00000144489
Gene: ENSMUSG00000106864

DomainStartEndE-ValueType
low complexity region 99 109 N/A INTRINSIC
low complexity region 144 159 N/A INTRINSIC
low complexity region 232 243 N/A INTRINSIC
low complexity region 250 268 N/A INTRINSIC
low complexity region 292 311 N/A INTRINSIC
low complexity region 476 488 N/A INTRINSIC
WD40 495 551 6.39e0 SMART
WD40 573 623 1.6e0 SMART
WD40 641 681 3.37e-6 SMART
WD40 864 904 5.33e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 96% (51/53)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 G A 2: 155,416,610 (GRCm39) probably null Het
Adamts10 G A 17: 33,750,590 (GRCm39) R210H probably benign Het
Als2 T C 1: 59,206,775 (GRCm39) probably null Het
Aplp2 A T 9: 31,063,652 (GRCm39) M652K possibly damaging Het
Atrn A G 2: 130,803,491 (GRCm39) I560M possibly damaging Het
Bicc1 T C 10: 70,782,434 (GRCm39) D602G possibly damaging Het
Bnip5 G A 17: 29,124,298 (GRCm39) R335W probably damaging Het
Cd200l2 T A 16: 45,348,855 (GRCm39) T106S possibly damaging Het
Cdh4 A G 2: 179,086,603 (GRCm39) probably null Het
Clasp1 T A 1: 118,470,727 (GRCm39) probably null Het
Col6a6 A G 9: 105,644,523 (GRCm39) I1255T probably damaging Het
Comp G T 8: 70,834,000 (GRCm39) V672L probably damaging Het
Dbnl T G 11: 5,745,486 (GRCm39) D122E probably damaging Het
Dgkz G A 2: 91,773,020 (GRCm39) R346C probably damaging Het
Dnhd1 C T 7: 105,327,516 (GRCm39) R54C probably damaging Het
Elmo3 T C 8: 106,033,346 (GRCm39) I121T probably damaging Het
Fam184b A G 5: 45,699,574 (GRCm39) L614P probably damaging Het
Fbh1 T C 2: 11,754,348 (GRCm39) R797G probably benign Het
Fcgbpl1 T A 7: 27,843,681 (GRCm39) C856* probably null Het
Gata6 A G 18: 11,059,108 (GRCm39) T392A probably damaging Het
Gm3424 T C 14: 17,337,195 (GRCm39) N88D possibly damaging Het
Gnas T A 2: 174,139,892 (GRCm39) S80T unknown Het
Hsd17b14 C A 7: 45,215,570 (GRCm39) P190Q probably damaging Het
Iqch C T 9: 63,352,803 (GRCm39) V955I possibly damaging Het
Kcnt2 T C 1: 140,304,122 (GRCm39) V164A probably benign Het
Krt87 A G 15: 101,336,515 (GRCm39) L46P probably damaging Het
Lef1 A G 3: 130,984,748 (GRCm39) M237V probably benign Het
Lmbr1l A T 15: 98,807,267 (GRCm39) probably null Het
Lrrc49 T C 9: 60,517,686 (GRCm39) I408V probably damaging Het
Luc7l3 T C 11: 94,186,791 (GRCm39) S365G unknown Het
Marchf2 A T 17: 33,922,032 (GRCm39) C109* probably null Het
Metrnl T A 11: 121,606,796 (GRCm39) C284S probably damaging Het
Mmachc G A 4: 116,563,082 (GRCm39) T91I probably benign Het
Mrps7 T G 11: 115,497,696 (GRCm39) M187R probably damaging Het
Ncapd3 A G 9: 26,978,336 (GRCm39) E845G probably damaging Het
Nscme3l G A 19: 5,553,439 (GRCm39) P114L probably benign Het
Ooep T A 9: 78,285,347 (GRCm39) T90S possibly damaging Het
Or13c25 A T 4: 52,911,376 (GRCm39) D139E probably benign Het
Or2y1g T A 11: 49,171,160 (GRCm39) F62I probably damaging Het
Pcdhb18 A T 18: 37,624,662 (GRCm39) D664V probably damaging Het
Pigz T C 16: 31,763,949 (GRCm39) S336P probably benign Het
Pou2f2 A T 7: 24,815,553 (GRCm39) D71E probably benign Het
Reep6 G T 10: 80,171,033 (GRCm39) R303L possibly damaging Het
Rmdn2 A T 17: 79,935,297 (GRCm39) S137C Het
Rnf220 A T 4: 117,347,127 (GRCm39) L95H probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,229,118 (GRCm39) probably benign Het
Stxbp1 A T 2: 32,708,517 (GRCm39) S83T probably damaging Het
Tcstv7b A T 13: 120,702,515 (GRCm39) M104L probably benign Het
Trappc11 T C 8: 47,958,617 (GRCm39) probably null Het
Ttn G T 2: 76,621,645 (GRCm39) D15598E probably damaging Het
Vav2 T A 2: 27,165,014 (GRCm39) R645W probably damaging Het
Vmn1r169 T A 7: 23,277,412 (GRCm39) V268D probably benign Het
Zp2 A T 7: 119,735,279 (GRCm39) C365S probably damaging Het
Other mutations in Gm29609
AlleleSourceChrCoordTypePredicted EffectPPH Score
R5104:Gm29609 UTSW 5 31,311,638 (GRCm39) splice site probably null
Z1176:Gm29609 UTSW 5 31,311,586 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CACGATAGGTCCCCAGATTCAG -3'
(R):5'- CAGACTGTCCTACACCGATG -3'

Sequencing Primer
(F):5'- CATGACCTGCAAGAACTC -3'
(R):5'- AGACTGTCCTACACCGATGTTTGG -3'
Posted On 2019-10-17