Incidental Mutation 'R7541:Vmn1r169'
ID583884
Institutional Source Beutler Lab
Gene Symbol Vmn1r169
Ensembl Gene ENSMUSG00000094602
Gene Namevomeronasal 1 receptor 169
SynonymsGm4232
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R7541 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location23575526-23578849 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 23577987 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 268 (V268D)
Ref Sequence ENSEMBL: ENSMUSP00000126133 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170290] [ENSMUST00000226669] [ENSMUST00000227547] [ENSMUST00000227932] [ENSMUST00000228832]
Predicted Effect probably benign
Transcript: ENSMUST00000170290
AA Change: V268D

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000126133
Gene: ENSMUSG00000094602
AA Change: V268D

DomainStartEndE-ValueType
Pfam:TAS2R 8 295 4e-14 PFAM
Pfam:V1R 41 295 2.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226669
AA Change: V268D

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000227547
AA Change: V268D

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000227932
AA Change: V268D

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000228832
AA Change: V268D

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 96% (51/53)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik G A 19: 5,503,411 P114L probably benign Het
4930539E08Rik G A 17: 28,905,324 R335W probably damaging Het
9530053A07Rik T A 7: 28,144,256 C856* probably null Het
Acss2 G A 2: 155,574,690 probably null Het
Adamts10 G A 17: 33,531,616 R210H probably benign Het
Als2 T C 1: 59,167,616 probably null Het
Aplp2 A T 9: 31,152,356 M652K possibly damaging Het
Atrn A G 2: 130,961,571 I560M possibly damaging Het
Bicc1 T C 10: 70,946,604 D602G possibly damaging Het
Cdh4 A G 2: 179,444,810 probably null Het
Clasp1 T A 1: 118,542,997 probably null Het
Col6a6 A G 9: 105,767,324 I1255T probably damaging Het
Comp G T 8: 70,381,350 V672L probably damaging Het
Dbnl T G 11: 5,795,486 D122E probably damaging Het
Dgkz G A 2: 91,942,675 R346C probably damaging Het
Dnhd1 C T 7: 105,678,309 R54C probably damaging Het
Elmo3 T C 8: 105,306,714 I121T probably damaging Het
Fam184b A G 5: 45,542,232 L614P probably damaging Het
Fbxo18 T C 2: 11,749,537 R797G probably benign Het
Gata6 A G 18: 11,059,108 T392A probably damaging Het
Gm17783 T A 16: 45,528,492 T106S possibly damaging Het
Gm21731 A T 13: 120,240,979 M104L probably benign Het
Gm29609 A G 5: 31,154,232 F855S probably benign Het
Gm3424 T C 14: 5,829,330 N88D possibly damaging Het
Gnas T A 2: 174,298,099 S80T unknown Het
Hsd17b14 C A 7: 45,566,146 P190Q probably damaging Het
Iqch C T 9: 63,445,521 V955I possibly damaging Het
Kcnt2 T C 1: 140,376,384 V164A probably benign Het
Krt87 A G 15: 101,438,634 L46P probably damaging Het
Lef1 A G 3: 131,191,099 M237V probably benign Het
Lmbr1l A T 15: 98,909,386 probably null Het
Lrrc49 T C 9: 60,610,403 I408V probably damaging Het
Luc7l3 T C 11: 94,295,965 S365G unknown Het
March2 A T 17: 33,703,058 C109* probably null Het
Metrnl T A 11: 121,715,970 C284S probably damaging Het
Mmachc G A 4: 116,705,885 T91I probably benign Het
Mrps7 T G 11: 115,606,870 M187R probably damaging Het
Ncapd3 A G 9: 27,067,040 E845G probably damaging Het
Olfr1393 T A 11: 49,280,333 F62I probably damaging Het
Olfr272 A T 4: 52,911,376 D139E probably benign Het
Ooep T A 9: 78,378,065 T90S possibly damaging Het
Pcdhb18 A T 18: 37,491,609 D664V probably damaging Het
Pigz T C 16: 31,945,131 S336P probably benign Het
Pou2f2 A T 7: 25,116,128 D71E probably benign Het
Reep6 G T 10: 80,335,199 R303L possibly damaging Het
Rmdn2 A T 17: 79,627,868 S137C Het
Rnf220 A T 4: 117,489,930 L95H probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,911 probably benign Het
Stxbp1 A T 2: 32,818,505 S83T probably damaging Het
Trappc11 T C 8: 47,505,582 probably null Het
Ttn G T 2: 76,791,301 D15598E probably damaging Het
Vav2 T A 2: 27,275,002 R645W probably damaging Het
Zp2 A T 7: 120,136,056 C365S probably damaging Het
Other mutations in Vmn1r169
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Vmn1r169 APN 7 23577594 missense probably damaging 1.00
IGL01019:Vmn1r169 APN 7 23577186 start codon destroyed probably null 0.99
IGL01667:Vmn1r169 APN 7 23577800 missense probably benign 0.17
IGL02246:Vmn1r169 APN 7 23577236 missense probably benign 0.09
IGL03303:Vmn1r169 APN 7 23578009 missense probably benign 0.40
R1345:Vmn1r169 UTSW 7 23577822 missense probably damaging 1.00
R6471:Vmn1r169 UTSW 7 23577545 missense probably benign 0.25
R7120:Vmn1r169 UTSW 7 23578019 missense probably benign 0.00
R7268:Vmn1r169 UTSW 7 23577428 missense probably benign 0.00
R8782:Vmn1r169 UTSW 7 23577978 missense possibly damaging 0.92
R8946:Vmn1r169 UTSW 7 23577215 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- ATGCAGTGTTCATCAGCATCATC -3'
(R):5'- ACAGAATATTGTTGGCTGTTAGGAGAG -3'

Sequencing Primer
(F):5'- TCAGCATCATCATCTGGAGCAGTG -3'
(R):5'- TGTTGGCTGTTAGGAGAGTTAAAAAG -3'
Posted On2019-10-17