Incidental Mutation 'R7541:Pou2f2'
ID 583885
Institutional Source Beutler Lab
Gene Symbol Pou2f2
Ensembl Gene ENSMUSG00000008496
Gene Name POU domain, class 2, transcription factor 2
Synonyms Oct-2, Otf-2, Oct2a, Otf2, Oct2b
MMRRC Submission
Accession Numbers

Genbank: NM_001163554; MGI: 101897

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7541 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 25087344-25179726 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 25116128 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 71 (D71E)
Ref Sequence ENSEMBL: ENSMUSP00000104056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098679] [ENSMUST00000108413] [ENSMUST00000108415] [ENSMUST00000108416] [ENSMUST00000108417] [ENSMUST00000108418] [ENSMUST00000147146] [ENSMUST00000175774] [ENSMUST00000176408]
AlphaFold Q00196
Predicted Effect possibly damaging
Transcript: ENSMUST00000098679
AA Change: D93E

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000096276
Gene: ENSMUSG00000008496
AA Change: D93E

DomainStartEndE-ValueType
low complexity region 95 114 N/A INTRINSIC
low complexity region 126 137 N/A INTRINSIC
low complexity region 142 158 N/A INTRINSIC
POU 201 275 7.65e-52 SMART
low complexity region 281 294 N/A INTRINSIC
HOX 303 365 3.8e-18 SMART
low complexity region 392 416 N/A INTRINSIC
low complexity region 422 432 N/A INTRINSIC
low complexity region 433 456 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108413
AA Change: D71E

PolyPhen 2 Score 0.502 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000104051
Gene: ENSMUSG00000008496
AA Change: D71E

DomainStartEndE-ValueType
low complexity region 73 92 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 120 136 N/A INTRINSIC
POU 179 253 7.65e-52 SMART
low complexity region 259 272 N/A INTRINSIC
HOX 281 343 3.8e-18 SMART
low complexity region 373 400 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108415
AA Change: D71E

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000104053
Gene: ENSMUSG00000008496
AA Change: D71E

DomainStartEndE-ValueType
low complexity region 73 92 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 120 136 N/A INTRINSIC
POU 195 269 7.65e-52 SMART
low complexity region 275 288 N/A INTRINSIC
HOX 297 359 3.8e-18 SMART
low complexity region 386 410 N/A INTRINSIC
low complexity region 416 426 N/A INTRINSIC
low complexity region 427 450 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108416
SMART Domains Protein: ENSMUSP00000104054
Gene: ENSMUSG00000008496

DomainStartEndE-ValueType
low complexity region 65 76 N/A INTRINSIC
low complexity region 81 97 N/A INTRINSIC
POU 140 214 7.65e-52 SMART
low complexity region 220 233 N/A INTRINSIC
HOX 242 304 3.8e-18 SMART
low complexity region 331 355 N/A INTRINSIC
low complexity region 361 371 N/A INTRINSIC
low complexity region 372 395 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108417
AA Change: D93E

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000104055
Gene: ENSMUSG00000008496
AA Change: D93E

DomainStartEndE-ValueType
low complexity region 95 114 N/A INTRINSIC
low complexity region 126 137 N/A INTRINSIC
low complexity region 142 158 N/A INTRINSIC
POU 201 275 7.65e-52 SMART
low complexity region 281 294 N/A INTRINSIC
HOX 303 365 3.8e-18 SMART
low complexity region 392 416 N/A INTRINSIC
low complexity region 422 432 N/A INTRINSIC
low complexity region 433 456 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108418
AA Change: D71E

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000104056
Gene: ENSMUSG00000008496
AA Change: D71E

DomainStartEndE-ValueType
low complexity region 73 92 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 120 136 N/A INTRINSIC
POU 179 253 7.65e-52 SMART
low complexity region 259 272 N/A INTRINSIC
HOX 281 343 3.8e-18 SMART
low complexity region 370 394 N/A INTRINSIC
low complexity region 400 410 N/A INTRINSIC
low complexity region 411 434 N/A INTRINSIC
low complexity region 490 509 N/A INTRINSIC
low complexity region 533 563 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000147146
AA Change: D37E
SMART Domains Protein: ENSMUSP00000118307
Gene: ENSMUSG00000008496
AA Change: D37E

DomainStartEndE-ValueType
low complexity region 39 58 N/A INTRINSIC
SCOP:d1gkub1 89 123 2e-3 SMART
low complexity region 134 151 N/A INTRINSIC
low complexity region 163 174 N/A INTRINSIC
low complexity region 179 195 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175774
AA Change: D71E

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000135075
Gene: ENSMUSG00000008496
AA Change: D71E

DomainStartEndE-ValueType
low complexity region 73 92 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 120 136 N/A INTRINSIC
POU 179 253 7.65e-52 SMART
low complexity region 259 272 N/A INTRINSIC
HOX 281 343 3.8e-18 SMART
low complexity region 370 394 N/A INTRINSIC
low complexity region 400 410 N/A INTRINSIC
low complexity region 411 434 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000176408
AA Change: D71E

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000135326
Gene: ENSMUSG00000008496
AA Change: D71E

DomainStartEndE-ValueType
low complexity region 73 92 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 120 136 N/A INTRINSIC
POU 195 269 7.65e-52 SMART
low complexity region 275 288 N/A INTRINSIC
HOX 297 359 3.8e-18 SMART
low complexity region 386 410 N/A INTRINSIC
low complexity region 416 426 N/A INTRINSIC
low complexity region 427 450 N/A INTRINSIC
Meta Mutation Damage Score 0.0710 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 96% (51/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a homeobox-containing transcription factor of the POU domain family. The encoded protein binds the octamer sequence 5'-ATTTGCAT-3', a common transcription factor binding site in immunoglobulin gene promoters. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous inactivation of this locus results in failed B cell maturation and death within hours of birth. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Gene trapped(2)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik G A 19: 5,503,411 P114L probably benign Het
4930539E08Rik G A 17: 28,905,324 R335W probably damaging Het
9530053A07Rik T A 7: 28,144,256 C856* probably null Het
Acss2 G A 2: 155,574,690 probably null Het
Adamts10 G A 17: 33,531,616 R210H probably benign Het
Als2 T C 1: 59,167,616 probably null Het
Aplp2 A T 9: 31,152,356 M652K possibly damaging Het
Atrn A G 2: 130,961,571 I560M possibly damaging Het
Bicc1 T C 10: 70,946,604 D602G possibly damaging Het
Cdh4 A G 2: 179,444,810 probably null Het
Clasp1 T A 1: 118,542,997 probably null Het
Col6a6 A G 9: 105,767,324 I1255T probably damaging Het
Comp G T 8: 70,381,350 V672L probably damaging Het
Dbnl T G 11: 5,795,486 D122E probably damaging Het
Dgkz G A 2: 91,942,675 R346C probably damaging Het
Dnhd1 C T 7: 105,678,309 R54C probably damaging Het
Elmo3 T C 8: 105,306,714 I121T probably damaging Het
Fam184b A G 5: 45,542,232 L614P probably damaging Het
Fbxo18 T C 2: 11,749,537 R797G probably benign Het
Gata6 A G 18: 11,059,108 T392A probably damaging Het
Gm17783 T A 16: 45,528,492 T106S possibly damaging Het
Gm21731 A T 13: 120,240,979 M104L probably benign Het
Gm29609 A G 5: 31,154,232 F855S probably benign Het
Gm3424 T C 14: 5,829,330 N88D possibly damaging Het
Gnas T A 2: 174,298,099 S80T unknown Het
Hsd17b14 C A 7: 45,566,146 P190Q probably damaging Het
Iqch C T 9: 63,445,521 V955I possibly damaging Het
Kcnt2 T C 1: 140,376,384 V164A probably benign Het
Krt87 A G 15: 101,438,634 L46P probably damaging Het
Lef1 A G 3: 131,191,099 M237V probably benign Het
Lmbr1l A T 15: 98,909,386 probably null Het
Lrrc49 T C 9: 60,610,403 I408V probably damaging Het
Luc7l3 T C 11: 94,295,965 S365G unknown Het
March2 A T 17: 33,703,058 C109* probably null Het
Metrnl T A 11: 121,715,970 C284S probably damaging Het
Mmachc G A 4: 116,705,885 T91I probably benign Het
Mrps7 T G 11: 115,606,870 M187R probably damaging Het
Ncapd3 A G 9: 27,067,040 E845G probably damaging Het
Olfr1393 T A 11: 49,280,333 F62I probably damaging Het
Olfr272 A T 4: 52,911,376 D139E probably benign Het
Ooep T A 9: 78,378,065 T90S possibly damaging Het
Pcdhb18 A T 18: 37,491,609 D664V probably damaging Het
Pigz T C 16: 31,945,131 S336P probably benign Het
Reep6 G T 10: 80,335,199 R303L possibly damaging Het
Rmdn2 A T 17: 79,627,868 S137C Het
Rnf220 A T 4: 117,489,930 L95H probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,911 probably benign Het
Stxbp1 A T 2: 32,818,505 S83T probably damaging Het
Trappc11 T C 8: 47,505,582 probably null Het
Ttn G T 2: 76,791,301 D15598E probably damaging Het
Vav2 T A 2: 27,275,002 R645W probably damaging Het
Vmn1r169 T A 7: 23,577,987 V268D probably benign Het
Zp2 A T 7: 120,136,056 C365S probably damaging Het
Other mutations in Pou2f2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00921:Pou2f2 APN 7 25092700 nonsense probably null
IGL01420:Pou2f2 APN 7 25092952 missense possibly damaging 0.79
IGL02219:Pou2f2 APN 7 25097682 missense probably damaging 1.00
IGL03038:Pou2f2 APN 7 25097152 missense probably damaging 1.00
IGL03173:Pou2f2 APN 7 25099946 splice site probably benign
D3080:Pou2f2 UTSW 7 25097133 splice site probably benign
R0347:Pou2f2 UTSW 7 25097701 missense probably damaging 1.00
R0385:Pou2f2 UTSW 7 25116076 nonsense probably null
R0842:Pou2f2 UTSW 7 25096930 missense probably damaging 1.00
R1665:Pou2f2 UTSW 7 25092724 missense possibly damaging 0.66
R1914:Pou2f2 UTSW 7 25100156 missense possibly damaging 0.71
R1915:Pou2f2 UTSW 7 25100156 missense possibly damaging 0.71
R4076:Pou2f2 UTSW 7 25097288 missense probably damaging 0.98
R4811:Pou2f2 UTSW 7 25097686 nonsense probably null
R4863:Pou2f2 UTSW 7 25097108 intron probably benign
R5362:Pou2f2 UTSW 7 25092895 missense probably benign 0.02
R5995:Pou2f2 UTSW 7 25097444 missense probably damaging 1.00
R6605:Pou2f2 UTSW 7 25093581 missense probably damaging 0.96
R7884:Pou2f2 UTSW 7 25116064 missense probably benign 0.39
R8123:Pou2f2 UTSW 7 25097008 missense possibly damaging 0.83
R8416:Pou2f2 UTSW 7 25116126 nonsense probably null
R8499:Pou2f2 UTSW 7 25100198 missense probably damaging 1.00
R8554:Pou2f2 UTSW 7 25115556 intron probably benign
R9122:Pou2f2 UTSW 7 25092877 missense probably benign
R9341:Pou2f2 UTSW 7 25094852 missense possibly damaging 0.88
R9343:Pou2f2 UTSW 7 25094852 missense possibly damaging 0.88
R9474:Pou2f2 UTSW 7 25094822 missense probably benign 0.02
R9576:Pou2f2 UTSW 7 25097144 missense probably benign 0.28
R9578:Pou2f2 UTSW 7 25097144 missense probably benign 0.28
RF014:Pou2f2 UTSW 7 25115737 missense unknown
Z1177:Pou2f2 UTSW 7 25093176 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATCTGAGTCAAGCAGTTAGGAG -3'
(R):5'- AAGTGGTCAGAGGCCTCAAG -3'

Sequencing Primer
(F):5'- ACACATCTTTTACAGGGCGG -3'
(R):5'- CCTCAAGCCATGGCCTG -3'
Posted On 2019-10-17