Incidental Mutation 'R7541:Hsd17b14'
ID583887
Institutional Source Beutler Lab
Gene Symbol Hsd17b14
Ensembl Gene ENSMUSG00000030825
Gene Namehydroxysteroid (17-beta) dehydrogenase 14
Synonyms0610039E24Rik, Dhrs10, retSDR3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R7541 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location45554893-45567752 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 45566146 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 190 (P190Q)
Ref Sequence ENSEMBL: ENSMUSP00000103381 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033098] [ENSMUST00000107752] [ENSMUST00000120864] [ENSMUST00000209204] [ENSMUST00000210300]
Predicted Effect probably benign
Transcript: ENSMUST00000033098
SMART Domains Protein: ENSMUSP00000033098
Gene: ENSMUSG00000030826

DomainStartEndE-ValueType
Pfam:Aminotran_4 101 351 5.4e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107752
AA Change: P190Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103381
Gene: ENSMUSG00000030825
AA Change: P190Q

DomainStartEndE-ValueType
Pfam:KR 10 187 4.3e-12 PFAM
Pfam:adh_short 10 200 2.9e-53 PFAM
Pfam:Epimerase 12 184 4.2e-7 PFAM
Pfam:adh_short_C2 16 250 8.3e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120864
SMART Domains Protein: ENSMUSP00000113045
Gene: ENSMUSG00000030826

DomainStartEndE-ValueType
Pfam:Aminotran_4 119 370 7.6e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209204
Predicted Effect silent
Transcript: ENSMUST00000210300
Predicted Effect probably benign
Transcript: ENSMUST00000210997
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 96% (51/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] 17-beta-hydroxysteroid dehydrogenases, such as HSD17B14, are primarily involved in metabolism of steroids at the C17 position and also of other substrates, such as fatty acids, prostaglandins, and xenobiotics (Lukacik et al., 2007 [PubMed 17067289]).[supplied by OMIM, Jun 2009]
PHENOTYPE: In a high-throughput phenotyping screen, male null mice exhibit infertility, decreased sperm production, testicular degeneration and an increased anxiety-like response to stress-induced hyperthermia. Homozygous null mice also show an increase in serum IgG2a in response to antigen challenge. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik G A 19: 5,503,411 P114L probably benign Het
4930539E08Rik G A 17: 28,905,324 R335W probably damaging Het
9530053A07Rik T A 7: 28,144,256 C856* probably null Het
Acss2 G A 2: 155,574,690 probably null Het
Adamts10 G A 17: 33,531,616 R210H probably benign Het
Als2 T C 1: 59,167,616 probably null Het
Aplp2 A T 9: 31,152,356 M652K possibly damaging Het
Atrn A G 2: 130,961,571 I560M possibly damaging Het
Bicc1 T C 10: 70,946,604 D602G possibly damaging Het
Cdh4 A G 2: 179,444,810 probably null Het
Clasp1 T A 1: 118,542,997 probably null Het
Col6a6 A G 9: 105,767,324 I1255T probably damaging Het
Comp G T 8: 70,381,350 V672L probably damaging Het
Dbnl T G 11: 5,795,486 D122E probably damaging Het
Dgkz G A 2: 91,942,675 R346C probably damaging Het
Dnhd1 C T 7: 105,678,309 R54C probably damaging Het
Elmo3 T C 8: 105,306,714 I121T probably damaging Het
Fam184b A G 5: 45,542,232 L614P probably damaging Het
Fbxo18 T C 2: 11,749,537 R797G probably benign Het
Gata6 A G 18: 11,059,108 T392A probably damaging Het
Gm17783 T A 16: 45,528,492 T106S possibly damaging Het
Gm21731 A T 13: 120,240,979 M104L probably benign Het
Gm29609 A G 5: 31,154,232 F855S probably benign Het
Gm3424 T C 14: 5,829,330 N88D possibly damaging Het
Gnas T A 2: 174,298,099 S80T unknown Het
Iqch C T 9: 63,445,521 V955I possibly damaging Het
Kcnt2 T C 1: 140,376,384 V164A probably benign Het
Krt87 A G 15: 101,438,634 L46P probably damaging Het
Lef1 A G 3: 131,191,099 M237V probably benign Het
Lmbr1l A T 15: 98,909,386 probably null Het
Lrrc49 T C 9: 60,610,403 I408V probably damaging Het
Luc7l3 T C 11: 94,295,965 S365G unknown Het
March2 A T 17: 33,703,058 C109* probably null Het
Metrnl T A 11: 121,715,970 C284S probably damaging Het
Mmachc G A 4: 116,705,885 T91I probably benign Het
Mrps7 T G 11: 115,606,870 M187R probably damaging Het
Ncapd3 A G 9: 27,067,040 E845G probably damaging Het
Olfr1393 T A 11: 49,280,333 F62I probably damaging Het
Olfr272 A T 4: 52,911,376 D139E probably benign Het
Ooep T A 9: 78,378,065 T90S possibly damaging Het
Pcdhb18 A T 18: 37,491,609 D664V probably damaging Het
Pigz T C 16: 31,945,131 S336P probably benign Het
Pou2f2 A T 7: 25,116,128 D71E probably benign Het
Reep6 G T 10: 80,335,199 R303L possibly damaging Het
Rmdn2 A T 17: 79,627,868 S137C Het
Rnf220 A T 4: 117,489,930 L95H probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,911 probably benign Het
Stxbp1 A T 2: 32,818,505 S83T probably damaging Het
Trappc11 T C 8: 47,505,582 probably null Het
Ttn G T 2: 76,791,301 D15598E probably damaging Het
Vav2 T A 2: 27,275,002 R645W probably damaging Het
Vmn1r169 T A 7: 23,577,987 V268D probably benign Het
Zp2 A T 7: 120,136,056 C365S probably damaging Het
Other mutations in Hsd17b14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Hsd17b14 APN 7 45566713 missense possibly damaging 0.72
IGL02504:Hsd17b14 APN 7 45556375 missense possibly damaging 0.84
IGL03126:Hsd17b14 APN 7 45556079 missense possibly damaging 0.83
IGL03279:Hsd17b14 APN 7 45566193 missense possibly damaging 0.72
IGL03493:Hsd17b14 APN 7 45556091 missense probably damaging 1.00
R0085:Hsd17b14 UTSW 7 45556410 unclassified probably benign
R4128:Hsd17b14 UTSW 7 45563008 missense probably damaging 1.00
R4513:Hsd17b14 UTSW 7 45562915 missense probably benign 0.24
R5903:Hsd17b14 UTSW 7 45565962 missense probably damaging 1.00
R6649:Hsd17b14 UTSW 7 45556076 missense probably damaging 1.00
R6899:Hsd17b14 UTSW 7 45562928 missense possibly damaging 0.90
R7829:Hsd17b14 UTSW 7 45566785 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- GTGACTGCCATGACCAAAGC -3'
(R):5'- ACTCACTCAAGTGTGTGCAC -3'

Sequencing Primer
(F):5'- ACATGGTGTCCGAGTCAA -3'
(R):5'- GGTAGTACATGCCTGTAACTCTAGC -3'
Posted On2019-10-17