Incidental Mutation 'R7541:Zp2'
ID583890
Institutional Source Beutler Lab
Gene Symbol Zp2
Ensembl Gene ENSMUSG00000030911
Gene Namezona pellucida glycoprotein 2
SynonymsZp-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R7541 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location120126772-120145291 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 120136056 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 365 (C365S)
Ref Sequence ENSEMBL: ENSMUSP00000033207 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033207] [ENSMUST00000207726] [ENSMUST00000208874]
Predicted Effect probably damaging
Transcript: ENSMUST00000033207
AA Change: C365S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033207
Gene: ENSMUSG00000030911
AA Change: C365S

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
ZP 364 630 1.06e-86 SMART
low complexity region 655 668 N/A INTRINSIC
transmembrane domain 684 703 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000207726
AA Change: C365S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000208874
AA Change: C365S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 96% (51/53)
MGI Phenotype FUNCTION: This gene encodes a member of the zona pellucida family of glycoproteins that play an important role in the survival of growing oocytes, successful fertilization and the passage of early embryos through the oviduct. The encoded preproprotein undergoes proteolytic processing to generate the mature polypeptide that is incorporated into the extracellular matrix surrounding mouse oocytes. Mice lacking the encoded protein develop defective zonae pellucidae that disrupt folliculogenesis, fertility and development. [provided by RefSeq, Sep 2016]
PHENOTYPE: Female homozygous mutants exhibit a thin zona pellucida matrix in early ovarian follicles that becomes disassociated in pre-ovulatory follicles. Few oocytes are produced, and any that are fertilized fail to survive to the two-cell stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik G A 19: 5,503,411 P114L probably benign Het
4930539E08Rik G A 17: 28,905,324 R335W probably damaging Het
9530053A07Rik T A 7: 28,144,256 C856* probably null Het
Acss2 G A 2: 155,574,690 probably null Het
Adamts10 G A 17: 33,531,616 R210H probably benign Het
Als2 T C 1: 59,167,616 probably null Het
Aplp2 A T 9: 31,152,356 M652K possibly damaging Het
Atrn A G 2: 130,961,571 I560M possibly damaging Het
Bicc1 T C 10: 70,946,604 D602G possibly damaging Het
Cdh4 A G 2: 179,444,810 probably null Het
Clasp1 T A 1: 118,542,997 probably null Het
Col6a6 A G 9: 105,767,324 I1255T probably damaging Het
Comp G T 8: 70,381,350 V672L probably damaging Het
Dbnl T G 11: 5,795,486 D122E probably damaging Het
Dgkz G A 2: 91,942,675 R346C probably damaging Het
Dnhd1 C T 7: 105,678,309 R54C probably damaging Het
Elmo3 T C 8: 105,306,714 I121T probably damaging Het
Fam184b A G 5: 45,542,232 L614P probably damaging Het
Fbxo18 T C 2: 11,749,537 R797G probably benign Het
Gata6 A G 18: 11,059,108 T392A probably damaging Het
Gm17783 T A 16: 45,528,492 T106S possibly damaging Het
Gm21731 A T 13: 120,240,979 M104L probably benign Het
Gm29609 A G 5: 31,154,232 F855S probably benign Het
Gm3424 T C 14: 5,829,330 N88D possibly damaging Het
Gnas T A 2: 174,298,099 S80T unknown Het
Hsd17b14 C A 7: 45,566,146 P190Q probably damaging Het
Iqch C T 9: 63,445,521 V955I possibly damaging Het
Kcnt2 T C 1: 140,376,384 V164A probably benign Het
Krt87 A G 15: 101,438,634 L46P probably damaging Het
Lef1 A G 3: 131,191,099 M237V probably benign Het
Lmbr1l A T 15: 98,909,386 probably null Het
Lrrc49 T C 9: 60,610,403 I408V probably damaging Het
Luc7l3 T C 11: 94,295,965 S365G unknown Het
March2 A T 17: 33,703,058 C109* probably null Het
Metrnl T A 11: 121,715,970 C284S probably damaging Het
Mmachc G A 4: 116,705,885 T91I probably benign Het
Mrps7 T G 11: 115,606,870 M187R probably damaging Het
Ncapd3 A G 9: 27,067,040 E845G probably damaging Het
Olfr1393 T A 11: 49,280,333 F62I probably damaging Het
Olfr272 A T 4: 52,911,376 D139E probably benign Het
Ooep T A 9: 78,378,065 T90S possibly damaging Het
Pcdhb18 A T 18: 37,491,609 D664V probably damaging Het
Pigz T C 16: 31,945,131 S336P probably benign Het
Pou2f2 A T 7: 25,116,128 D71E probably benign Het
Reep6 G T 10: 80,335,199 R303L possibly damaging Het
Rmdn2 A T 17: 79,627,868 S137C Het
Rnf220 A T 4: 117,489,930 L95H probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,911 probably benign Het
Stxbp1 A T 2: 32,818,505 S83T probably damaging Het
Trappc11 T C 8: 47,505,582 probably null Het
Ttn G T 2: 76,791,301 D15598E probably damaging Het
Vav2 T A 2: 27,275,002 R645W probably damaging Het
Vmn1r169 T A 7: 23,577,987 V268D probably benign Het
Other mutations in Zp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Zp2 APN 7 120133400 missense probably benign 0.00
IGL00707:Zp2 APN 7 120133413 missense probably benign 0.03
IGL00916:Zp2 APN 7 120138174 missense probably damaging 1.00
IGL01554:Zp2 APN 7 120138325 missense possibly damaging 0.78
IGL01845:Zp2 APN 7 120138191 missense probably damaging 1.00
IGL02111:Zp2 APN 7 120132418 missense possibly damaging 0.75
IGL02145:Zp2 APN 7 120139851 critical splice acceptor site probably null
IGL02155:Zp2 APN 7 120144117 missense probably benign 0.00
IGL02178:Zp2 APN 7 120133750 missense possibly damaging 0.85
IGL02646:Zp2 APN 7 120135341 missense possibly damaging 0.92
IGL03220:Zp2 APN 7 120137227 missense possibly damaging 0.90
PIT4687001:Zp2 UTSW 7 120141879 missense probably benign 0.00
R0138:Zp2 UTSW 7 120137200 missense probably damaging 0.96
R0197:Zp2 UTSW 7 120143576 splice site probably benign
R0519:Zp2 UTSW 7 120138149 missense probably damaging 1.00
R0573:Zp2 UTSW 7 120135470 splice site probably benign
R0879:Zp2 UTSW 7 120135534 missense probably damaging 1.00
R0883:Zp2 UTSW 7 120143576 splice site probably benign
R1160:Zp2 UTSW 7 120136045 missense probably damaging 1.00
R1235:Zp2 UTSW 7 120138343 missense possibly damaging 0.57
R1753:Zp2 UTSW 7 120138105 missense probably benign
R1883:Zp2 UTSW 7 120133401 missense probably benign 0.02
R1995:Zp2 UTSW 7 120135165 missense probably damaging 0.97
R2196:Zp2 UTSW 7 120138306 missense probably benign
R2850:Zp2 UTSW 7 120138306 missense probably benign
R3715:Zp2 UTSW 7 120141834 missense possibly damaging 0.95
R3931:Zp2 UTSW 7 120132357 intron probably benign
R4082:Zp2 UTSW 7 120135252 missense probably benign 0.01
R4731:Zp2 UTSW 7 120138120 missense probably damaging 0.96
R4732:Zp2 UTSW 7 120138120 missense probably damaging 0.96
R4733:Zp2 UTSW 7 120138120 missense probably damaging 0.96
R4754:Zp2 UTSW 7 120138318 missense probably benign 0.01
R4863:Zp2 UTSW 7 120135772 missense probably damaging 1.00
R5274:Zp2 UTSW 7 120138092 missense possibly damaging 0.92
R5392:Zp2 UTSW 7 120135764 nonsense probably null
R5877:Zp2 UTSW 7 120133339 missense probably null 0.94
R6390:Zp2 UTSW 7 120141230 missense probably benign 0.23
R6404:Zp2 UTSW 7 120135542 missense possibly damaging 0.73
R6546:Zp2 UTSW 7 120132525 missense probably benign 0.00
R6622:Zp2 UTSW 7 120132525 missense probably benign 0.00
R6622:Zp2 UTSW 7 120141913 missense probably benign
R6707:Zp2 UTSW 7 120133922 missense possibly damaging 0.85
R7274:Zp2 UTSW 7 120132391 makesense probably null
R7275:Zp2 UTSW 7 120135353 splice site probably null
R7585:Zp2 UTSW 7 120133944 missense probably damaging 1.00
R7709:Zp2 UTSW 7 120135775 missense probably damaging 1.00
R7742:Zp2 UTSW 7 120132508 missense unknown
R7767:Zp2 UTSW 7 120137169 missense probably benign 0.01
R7771:Zp2 UTSW 7 120143642 missense probably damaging 0.96
R8391:Zp2 UTSW 7 120126956 missense probably benign 0.00
R8872:Zp2 UTSW 7 120133802 missense probably benign 0.14
R8880:Zp2 UTSW 7 120143612 missense possibly damaging 0.80
X0017:Zp2 UTSW 7 120133385 missense probably damaging 1.00
X0023:Zp2 UTSW 7 120133367 missense probably damaging 1.00
Z1176:Zp2 UTSW 7 120135179 missense not run
Z1177:Zp2 UTSW 7 120135179 missense not run
Z1177:Zp2 UTSW 7 120135209 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCATAAGTTGCTACTCACTTTCTG -3'
(R):5'- CTTCTGATCTGCATGACGGTG -3'

Sequencing Primer
(F):5'- GCCTTGTTCCACATCCATTCAGAG -3'
(R):5'- ATCTGCATGACGGTGACACTG -3'
Posted On2019-10-17