Incidental Mutation 'R7541:Comp'
ID583891
Institutional Source Beutler Lab
Gene Symbol Comp
Ensembl Gene ENSMUSG00000031849
Gene Namecartilage oligomeric matrix protein
Synonymsthrombospondin-5, TSP5
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.348) question?
Stock #R7541 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location70373558-70382066 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 70381350 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 672 (V672L)
Ref Sequence ENSEMBL: ENSMUSP00000003659 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003659] [ENSMUST00000076615]
PDB Structure Storage function of COMP:the crystal structure of the coiled-coil domain in complex with vitamin D3 [X-RAY DIFFRACTION]
COMPcc in complex with fatty acids [X-RAY DIFFRACTION]
COMPcc in complex with fatty acids [X-RAY DIFFRACTION]
COMPcc in complex with fatty acids [X-RAY DIFFRACTION]
COMPcc in complex with fatty acids [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000003659
AA Change: V672L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000003659
Gene: ENSMUSG00000031849
AA Change: V672L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:COMP 28 72 6.2e-22 PFAM
EGF 88 124 8.19e-2 SMART
EGF_CA 125 177 5.08e-7 SMART
EGF_CA 178 220 1.73e-9 SMART
EGF 226 265 7.53e-1 SMART
Pfam:TSP_3 299 334 6.1e-16 PFAM
Pfam:TSP_3 358 393 1.2e-15 PFAM
Pfam:TSP_3 393 416 2.7e-6 PFAM
Pfam:TSP_3 417 454 1.6e-14 PFAM
Pfam:TSP_3 455 490 3.7e-14 PFAM
Pfam:TSP_3 491 526 6.1e-15 PFAM
Pfam:TSP_C 544 741 2.6e-101 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000076615
SMART Domains Protein: ENSMUSP00000075916
Gene: ENSMUSG00000003575

DomainStartEndE-ValueType
Pfam:TORC_N 6 66 1.1e-26 PFAM
Pfam:TORC_M 148 289 4.8e-64 PFAM
low complexity region 359 394 N/A INTRINSIC
Pfam:TORC_C 555 630 9.2e-36 PFAM
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000213072
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 96% (51/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a noncollagenous extracellular matrix (ECM) protein. It consists of five identical glycoprotein subunits, each with EGF-like and calcium-binding (thrombospondin-like) domains. Oligomerization results from formation of a five-stranded coiled coil and disulfides. Binding to other ECM proteins such as collagen appears to depend on divalent cations. Contraction or expansion of a 5 aa aspartate repeat and other mutations can cause pseudochondroplasia (PSACH) and multiple epiphyseal dysplasia (MED). [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a targeted null mutation are indistinguishable from controls. Mice homozygous for a knockin allele with two point mutations exhibit short limb dwarfism, osteoarthritis, abnormal chondrocytes, mild myopathy, and abnormal tendon morphology and stiffness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik G A 19: 5,503,411 P114L probably benign Het
4930539E08Rik G A 17: 28,905,324 R335W probably damaging Het
9530053A07Rik T A 7: 28,144,256 C856* probably null Het
Acss2 G A 2: 155,574,690 probably null Het
Adamts10 G A 17: 33,531,616 R210H probably benign Het
Als2 T C 1: 59,167,616 probably null Het
Aplp2 A T 9: 31,152,356 M652K possibly damaging Het
Atrn A G 2: 130,961,571 I560M possibly damaging Het
Bicc1 T C 10: 70,946,604 D602G possibly damaging Het
Cdh4 A G 2: 179,444,810 probably null Het
Clasp1 T A 1: 118,542,997 probably null Het
Col6a6 A G 9: 105,767,324 I1255T probably damaging Het
Dbnl T G 11: 5,795,486 D122E probably damaging Het
Dgkz G A 2: 91,942,675 R346C probably damaging Het
Dnhd1 C T 7: 105,678,309 R54C probably damaging Het
Elmo3 T C 8: 105,306,714 I121T probably damaging Het
Fam184b A G 5: 45,542,232 L614P probably damaging Het
Fbxo18 T C 2: 11,749,537 R797G probably benign Het
Gata6 A G 18: 11,059,108 T392A probably damaging Het
Gm17783 T A 16: 45,528,492 T106S possibly damaging Het
Gm21731 A T 13: 120,240,979 M104L probably benign Het
Gm29609 A G 5: 31,154,232 F855S probably benign Het
Gm3424 T C 14: 5,829,330 N88D possibly damaging Het
Gnas T A 2: 174,298,099 S80T unknown Het
Hsd17b14 C A 7: 45,566,146 P190Q probably damaging Het
Iqch C T 9: 63,445,521 V955I possibly damaging Het
Kcnt2 T C 1: 140,376,384 V164A probably benign Het
Krt87 A G 15: 101,438,634 L46P probably damaging Het
Lef1 A G 3: 131,191,099 M237V probably benign Het
Lmbr1l A T 15: 98,909,386 probably null Het
Lrrc49 T C 9: 60,610,403 I408V probably damaging Het
Luc7l3 T C 11: 94,295,965 S365G unknown Het
March2 A T 17: 33,703,058 C109* probably null Het
Metrnl T A 11: 121,715,970 C284S probably damaging Het
Mmachc G A 4: 116,705,885 T91I probably benign Het
Mrps7 T G 11: 115,606,870 M187R probably damaging Het
Ncapd3 A G 9: 27,067,040 E845G probably damaging Het
Olfr1393 T A 11: 49,280,333 F62I probably damaging Het
Olfr272 A T 4: 52,911,376 D139E probably benign Het
Ooep T A 9: 78,378,065 T90S possibly damaging Het
Pcdhb18 A T 18: 37,491,609 D664V probably damaging Het
Pigz T C 16: 31,945,131 S336P probably benign Het
Pou2f2 A T 7: 25,116,128 D71E probably benign Het
Reep6 G T 10: 80,335,199 R303L possibly damaging Het
Rmdn2 A T 17: 79,627,868 S137C Het
Rnf220 A T 4: 117,489,930 L95H probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,911 probably benign Het
Stxbp1 A T 2: 32,818,505 S83T probably damaging Het
Trappc11 T C 8: 47,505,582 probably null Het
Ttn G T 2: 76,791,301 D15598E probably damaging Het
Vav2 T A 2: 27,275,002 R645W probably damaging Het
Vmn1r169 T A 7: 23,577,987 V268D probably benign Het
Zp2 A T 7: 120,136,056 C365S probably damaging Het
Other mutations in Comp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01596:Comp APN 8 70378635 missense probably damaging 1.00
IGL02110:Comp APN 8 70373639 missense probably benign 0.08
IGL02721:Comp APN 8 70376081 missense probably damaging 1.00
IGL02812:Comp APN 8 70376687 missense possibly damaging 0.75
IGL03023:Comp APN 8 70378610 unclassified probably benign
BB007:Comp UTSW 8 70373853 missense probably damaging 1.00
BB017:Comp UTSW 8 70373853 missense probably damaging 1.00
IGL03047:Comp UTSW 8 70374909 missense possibly damaging 0.65
R0217:Comp UTSW 8 70378908 missense probably damaging 1.00
R0503:Comp UTSW 8 70375734 missense possibly damaging 0.58
R0659:Comp UTSW 8 70379101 missense possibly damaging 0.84
R1490:Comp UTSW 8 70373913 missense possibly damaging 0.63
R1663:Comp UTSW 8 70373600 missense possibly damaging 0.93
R1666:Comp UTSW 8 70378957 splice site probably null
R1668:Comp UTSW 8 70378957 splice site probably null
R1789:Comp UTSW 8 70377146 missense probably benign 0.01
R2096:Comp UTSW 8 70376063 missense probably damaging 1.00
R2157:Comp UTSW 8 70379570 nonsense probably null
R3836:Comp UTSW 8 70373859 missense probably benign 0.26
R4630:Comp UTSW 8 70374382 missense possibly damaging 0.94
R4743:Comp UTSW 8 70376061 missense probably damaging 1.00
R4747:Comp UTSW 8 70376702 missense probably damaging 1.00
R5028:Comp UTSW 8 70376640 missense probably damaging 0.99
R5070:Comp UTSW 8 70376495 missense probably benign 0.25
R5083:Comp UTSW 8 70381300 missense probably damaging 1.00
R5917:Comp UTSW 8 70376361 splice site probably null
R6705:Comp UTSW 8 70376737 missense probably damaging 0.98
R6965:Comp UTSW 8 70376514 missense probably damaging 1.00
R7309:Comp UTSW 8 70373678 splice site probably null
R7402:Comp UTSW 8 70377204 missense probably benign 0.01
R7501:Comp UTSW 8 70379409 missense possibly damaging 0.82
R7568:Comp UTSW 8 70373859 missense probably benign 0.26
R7930:Comp UTSW 8 70373853 missense probably damaging 1.00
R8103:Comp UTSW 8 70381286 missense probably damaging 1.00
R8259:Comp UTSW 8 70379054 missense probably damaging 1.00
R8271:Comp UTSW 8 70376460 missense probably damaging 1.00
R8677:Comp UTSW 8 70380260 missense probably damaging 1.00
Z1177:Comp UTSW 8 70377221 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TGCCCTCTTGAAGCAAGGAC -3'
(R):5'- CCTGTACATAGGAGGTATTGGG -3'

Sequencing Primer
(F):5'- TCTTGAAGCAAGGACCTTCC -3'
(R):5'- GGTTCTGGCATCTCCCCGTAAG -3'
Posted On2019-10-17