Incidental Mutation 'R7541:Elmo3'
ID 583892
Institutional Source Beutler Lab
Gene Symbol Elmo3
Ensembl Gene ENSMUSG00000014791
Gene Name engulfment and cell motility 3
Synonyms CED-12
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7541 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 105305601-105310760 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 105306714 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 121 (I121T)
Ref Sequence ENSEMBL: ENSMUSP00000105000 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015003] [ENSMUST00000109375] [ENSMUST00000212033] [ENSMUST00000212046]
AlphaFold Q8BYZ7
Predicted Effect probably benign
Transcript: ENSMUST00000015003
SMART Domains Protein: ENSMUSP00000015003
Gene: ENSMUSG00000014859

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
E2F_TDP 17 83 3.56e-31 SMART
Pfam:E2F_CC-MB 100 196 2.8e-36 PFAM
low complexity region 201 252 N/A INTRINSIC
low complexity region 360 372 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109375
AA Change: I121T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105000
Gene: ENSMUSG00000014791
AA Change: I121T

DomainStartEndE-ValueType
Pfam:DUF3361 115 268 3.8e-55 PFAM
Pfam:ELMO_CED12 291 468 1.1e-42 PFAM
PH 542 665 2.17e0 SMART
low complexity region 694 706 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000212033
AA Change: I104T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000212046
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 96% (51/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to a C. elegans protein that functions in phagocytosis of apoptotic cells and in cell migration. Other members of this small family of engulfment and cell motility (ELMO) proteins have been shown to interact with the dedicator of cyto-kinesis 1 protein to promote phagocytosis and effect cell shape changes. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik G A 19: 5,503,411 P114L probably benign Het
4930539E08Rik G A 17: 28,905,324 R335W probably damaging Het
9530053A07Rik T A 7: 28,144,256 C856* probably null Het
Acss2 G A 2: 155,574,690 probably null Het
Adamts10 G A 17: 33,531,616 R210H probably benign Het
Als2 T C 1: 59,167,616 probably null Het
Aplp2 A T 9: 31,152,356 M652K possibly damaging Het
Atrn A G 2: 130,961,571 I560M possibly damaging Het
Bicc1 T C 10: 70,946,604 D602G possibly damaging Het
Cdh4 A G 2: 179,444,810 probably null Het
Clasp1 T A 1: 118,542,997 probably null Het
Col6a6 A G 9: 105,767,324 I1255T probably damaging Het
Comp G T 8: 70,381,350 V672L probably damaging Het
Dbnl T G 11: 5,795,486 D122E probably damaging Het
Dgkz G A 2: 91,942,675 R346C probably damaging Het
Dnhd1 C T 7: 105,678,309 R54C probably damaging Het
Fam184b A G 5: 45,542,232 L614P probably damaging Het
Fbxo18 T C 2: 11,749,537 R797G probably benign Het
Gata6 A G 18: 11,059,108 T392A probably damaging Het
Gm17783 T A 16: 45,528,492 T106S possibly damaging Het
Gm21731 A T 13: 120,240,979 M104L probably benign Het
Gm29609 A G 5: 31,154,232 F855S probably benign Het
Gm3424 T C 14: 5,829,330 N88D possibly damaging Het
Gnas T A 2: 174,298,099 S80T unknown Het
Hsd17b14 C A 7: 45,566,146 P190Q probably damaging Het
Iqch C T 9: 63,445,521 V955I possibly damaging Het
Kcnt2 T C 1: 140,376,384 V164A probably benign Het
Krt87 A G 15: 101,438,634 L46P probably damaging Het
Lef1 A G 3: 131,191,099 M237V probably benign Het
Lmbr1l A T 15: 98,909,386 probably null Het
Lrrc49 T C 9: 60,610,403 I408V probably damaging Het
Luc7l3 T C 11: 94,295,965 S365G unknown Het
March2 A T 17: 33,703,058 C109* probably null Het
Metrnl T A 11: 121,715,970 C284S probably damaging Het
Mmachc G A 4: 116,705,885 T91I probably benign Het
Mrps7 T G 11: 115,606,870 M187R probably damaging Het
Ncapd3 A G 9: 27,067,040 E845G probably damaging Het
Olfr1393 T A 11: 49,280,333 F62I probably damaging Het
Olfr272 A T 4: 52,911,376 D139E probably benign Het
Ooep T A 9: 78,378,065 T90S possibly damaging Het
Pcdhb18 A T 18: 37,491,609 D664V probably damaging Het
Pigz T C 16: 31,945,131 S336P probably benign Het
Pou2f2 A T 7: 25,116,128 D71E probably benign Het
Reep6 G T 10: 80,335,199 R303L possibly damaging Het
Rmdn2 A T 17: 79,627,868 S137C Het
Rnf220 A T 4: 117,489,930 L95H probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,911 probably benign Het
Stxbp1 A T 2: 32,818,505 S83T probably damaging Het
Trappc11 T C 8: 47,505,582 probably null Het
Ttn G T 2: 76,791,301 D15598E probably damaging Het
Vav2 T A 2: 27,275,002 R645W probably damaging Het
Vmn1r169 T A 7: 23,577,987 V268D probably benign Het
Zp2 A T 7: 120,136,056 C365S probably damaging Het
Other mutations in Elmo3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02183:Elmo3 APN 8 105308323 missense probably benign 0.22
IGL02580:Elmo3 APN 8 105308494 missense probably damaging 1.00
IGL03126:Elmo3 APN 8 105306381 missense probably damaging 1.00
IGL03349:Elmo3 APN 8 105306388 missense possibly damaging 0.95
R0119:Elmo3 UTSW 8 105309768 missense probably damaging 1.00
R0244:Elmo3 UTSW 8 105309171 missense probably benign 0.03
R1572:Elmo3 UTSW 8 105308301 missense probably benign 0.03
R1861:Elmo3 UTSW 8 105308581 missense probably damaging 1.00
R2143:Elmo3 UTSW 8 105308673 missense probably damaging 1.00
R2344:Elmo3 UTSW 8 105309161 missense probably damaging 1.00
R2920:Elmo3 UTSW 8 105308059 missense possibly damaging 0.61
R3687:Elmo3 UTSW 8 105308836 critical splice donor site probably null
R3944:Elmo3 UTSW 8 105309220 critical splice donor site probably null
R4992:Elmo3 UTSW 8 105309501 nonsense probably null
R5255:Elmo3 UTSW 8 105307353 missense probably benign 0.08
R5976:Elmo3 UTSW 8 105307647 missense probably damaging 1.00
R6340:Elmo3 UTSW 8 105306747 missense probably damaging 1.00
R6826:Elmo3 UTSW 8 105306746 missense probably damaging 1.00
R7788:Elmo3 UTSW 8 105308244 missense probably damaging 0.98
R7860:Elmo3 UTSW 8 105309017 missense probably damaging 1.00
R8553:Elmo3 UTSW 8 105307178 missense probably benign 0.02
R9586:Elmo3 UTSW 8 105308128 missense probably damaging 1.00
V8831:Elmo3 UTSW 8 105307061 missense probably benign 0.24
X0060:Elmo3 UTSW 8 105306013 splice site probably null
Predicted Primers PCR Primer
(F):5'- TTAGTGCCCTACCTAGTGGG -3'
(R):5'- TGAGCTCCAAGAAAGCCCTTAG -3'

Sequencing Primer
(F):5'- ATCACAGCTCCAGTTGTAGGG -3'
(R):5'- TTAGACCAAGGGCCAGCATCTC -3'
Posted On 2019-10-17