Incidental Mutation 'R7541:Or2y1g'
ID 583902
Institutional Source Beutler Lab
Gene Symbol Or2y1g
Ensembl Gene ENSMUSG00000059864
Gene Name olfactory receptor family 2 subfamily Y member 1G
Synonyms Olfr1393, MOR256-24, GA_x6K02T2QP88-6154577-6153642, MOR256-67_i
MMRRC Submission 045613-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.060) question?
Stock # R7541 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 49169131-49173596 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 49171160 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 62 (F62I)
Ref Sequence ENSEMBL: ENSMUSP00000149358 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078932] [ENSMUST00000213323] [ENSMUST00000214170] [ENSMUST00000214598] [ENSMUST00000215861] [ENSMUST00000217275]
AlphaFold Q8VFA7
Predicted Effect probably damaging
Transcript: ENSMUST00000078932
AA Change: F62I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077962
Gene: ENSMUSG00000059864
AA Change: F62I

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.3e-48 PFAM
Pfam:7TM_GPCR_Srsx 35 230 3e-6 PFAM
Pfam:7tm_1 41 289 5.8e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213323
AA Change: F62I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000214170
Predicted Effect probably benign
Transcript: ENSMUST00000214598
Predicted Effect probably benign
Transcript: ENSMUST00000215861
Predicted Effect probably benign
Transcript: ENSMUST00000217275
Meta Mutation Damage Score 0.4364 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 96% (51/53)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 G A 2: 155,416,610 (GRCm39) probably null Het
Adamts10 G A 17: 33,750,590 (GRCm39) R210H probably benign Het
Als2 T C 1: 59,206,775 (GRCm39) probably null Het
Aplp2 A T 9: 31,063,652 (GRCm39) M652K possibly damaging Het
Atrn A G 2: 130,803,491 (GRCm39) I560M possibly damaging Het
Bicc1 T C 10: 70,782,434 (GRCm39) D602G possibly damaging Het
Bnip5 G A 17: 29,124,298 (GRCm39) R335W probably damaging Het
Cd200l2 T A 16: 45,348,855 (GRCm39) T106S possibly damaging Het
Cdh4 A G 2: 179,086,603 (GRCm39) probably null Het
Clasp1 T A 1: 118,470,727 (GRCm39) probably null Het
Col6a6 A G 9: 105,644,523 (GRCm39) I1255T probably damaging Het
Comp G T 8: 70,834,000 (GRCm39) V672L probably damaging Het
Dbnl T G 11: 5,745,486 (GRCm39) D122E probably damaging Het
Dgkz G A 2: 91,773,020 (GRCm39) R346C probably damaging Het
Dnhd1 C T 7: 105,327,516 (GRCm39) R54C probably damaging Het
Elmo3 T C 8: 106,033,346 (GRCm39) I121T probably damaging Het
Fam184b A G 5: 45,699,574 (GRCm39) L614P probably damaging Het
Fbh1 T C 2: 11,754,348 (GRCm39) R797G probably benign Het
Fcgbpl1 T A 7: 27,843,681 (GRCm39) C856* probably null Het
Gata6 A G 18: 11,059,108 (GRCm39) T392A probably damaging Het
Gm29609 A G 5: 31,311,576 (GRCm39) F855S probably benign Het
Gm3424 T C 14: 17,337,195 (GRCm39) N88D possibly damaging Het
Gnas T A 2: 174,139,892 (GRCm39) S80T unknown Het
Hsd17b14 C A 7: 45,215,570 (GRCm39) P190Q probably damaging Het
Iqch C T 9: 63,352,803 (GRCm39) V955I possibly damaging Het
Kcnt2 T C 1: 140,304,122 (GRCm39) V164A probably benign Het
Krt87 A G 15: 101,336,515 (GRCm39) L46P probably damaging Het
Lef1 A G 3: 130,984,748 (GRCm39) M237V probably benign Het
Lmbr1l A T 15: 98,807,267 (GRCm39) probably null Het
Lrrc49 T C 9: 60,517,686 (GRCm39) I408V probably damaging Het
Luc7l3 T C 11: 94,186,791 (GRCm39) S365G unknown Het
Marchf2 A T 17: 33,922,032 (GRCm39) C109* probably null Het
Metrnl T A 11: 121,606,796 (GRCm39) C284S probably damaging Het
Mmachc G A 4: 116,563,082 (GRCm39) T91I probably benign Het
Mrps7 T G 11: 115,497,696 (GRCm39) M187R probably damaging Het
Ncapd3 A G 9: 26,978,336 (GRCm39) E845G probably damaging Het
Nscme3l G A 19: 5,553,439 (GRCm39) P114L probably benign Het
Ooep T A 9: 78,285,347 (GRCm39) T90S possibly damaging Het
Or13c25 A T 4: 52,911,376 (GRCm39) D139E probably benign Het
Pcdhb18 A T 18: 37,624,662 (GRCm39) D664V probably damaging Het
Pigz T C 16: 31,763,949 (GRCm39) S336P probably benign Het
Pou2f2 A T 7: 24,815,553 (GRCm39) D71E probably benign Het
Reep6 G T 10: 80,171,033 (GRCm39) R303L possibly damaging Het
Rmdn2 A T 17: 79,935,297 (GRCm39) S137C Het
Rnf220 A T 4: 117,347,127 (GRCm39) L95H probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,229,118 (GRCm39) probably benign Het
Stxbp1 A T 2: 32,708,517 (GRCm39) S83T probably damaging Het
Tcstv7b A T 13: 120,702,515 (GRCm39) M104L probably benign Het
Trappc11 T C 8: 47,958,617 (GRCm39) probably null Het
Ttn G T 2: 76,621,645 (GRCm39) D15598E probably damaging Het
Vav2 T A 2: 27,165,014 (GRCm39) R645W probably damaging Het
Vmn1r169 T A 7: 23,277,412 (GRCm39) V268D probably benign Het
Zp2 A T 7: 119,735,279 (GRCm39) C365S probably damaging Het
Other mutations in Or2y1g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01401:Or2y1g APN 11 49,171,314 (GRCm39) missense possibly damaging 0.94
IGL02291:Or2y1g APN 11 49,171,812 (GRCm39) missense probably damaging 1.00
IGL03127:Or2y1g APN 11 49,171,599 (GRCm39) missense possibly damaging 0.88
R0580:Or2y1g UTSW 11 49,171,449 (GRCm39) missense probably damaging 0.97
R1985:Or2y1g UTSW 11 49,171,110 (GRCm39) missense probably damaging 1.00
R4812:Or2y1g UTSW 11 49,171,284 (GRCm39) missense possibly damaging 0.94
R5190:Or2y1g UTSW 11 49,171,209 (GRCm39) missense probably damaging 0.99
R6694:Or2y1g UTSW 11 49,171,379 (GRCm39) missense probably benign 0.01
R6911:Or2y1g UTSW 11 49,171,634 (GRCm39) missense probably benign 0.22
R7012:Or2y1g UTSW 11 49,171,823 (GRCm39) missense probably benign 0.07
R7159:Or2y1g UTSW 11 49,171,185 (GRCm39) missense probably damaging 1.00
R7759:Or2y1g UTSW 11 49,171,463 (GRCm39) missense probably benign 0.00
R8767:Or2y1g UTSW 11 49,171,227 (GRCm39) missense possibly damaging 0.87
R9069:Or2y1g UTSW 11 49,171,247 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GCCTTCGGGTACTTGTTCAG -3'
(R):5'- CATAGCGGTCAAAAGCCATC -3'

Sequencing Primer
(F):5'- ACTTGTTCAGGTCAAAGGCTATG -3'
(R):5'- GCGGTCAAAAGCCATCACCAC -3'
Posted On 2019-10-17