Incidental Mutation 'R7541:Luc7l3'
ID583903
Institutional Source Beutler Lab
Gene Symbol Luc7l3
Ensembl Gene ENSMUSG00000020863
Gene NameLUC7-like 3 (S. cerevisiae)
Synonyms3300001P08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R7541 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location94287890-94321988 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 94295965 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 365 (S365G)
Ref Sequence ENSEMBL: ENSMUSP00000021226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021226] [ENSMUST00000107820] [ENSMUST00000107821] [ENSMUST00000107822] [ENSMUST00000166312]
Predicted Effect unknown
Transcript: ENSMUST00000021226
AA Change: S365G
SMART Domains Protein: ENSMUSP00000021226
Gene: ENSMUSG00000020863
AA Change: S365G

DomainStartEndE-ValueType
Pfam:LUC7 3 293 2.3e-89 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000107820
AA Change: S365G
SMART Domains Protein: ENSMUSP00000103450
Gene: ENSMUSG00000020863
AA Change: S365G

DomainStartEndE-ValueType
Pfam:LUC7 1 302 4.2e-72 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000107821
AA Change: S365G
SMART Domains Protein: ENSMUSP00000103451
Gene: ENSMUSG00000020863
AA Change: S365G

DomainStartEndE-ValueType
Pfam:LUC7 1 302 4.2e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107822
Predicted Effect
SMART Domains Protein: ENSMUSP00000131166
Gene: ENSMUSG00000020863
AA Change: S100G

DomainStartEndE-ValueType
coiled coil region 1 31 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138369
Predicted Effect unknown
Transcript: ENSMUST00000166312
AA Change: S365G
SMART Domains Protein: ENSMUSP00000129919
Gene: ENSMUSG00000020863
AA Change: S365G

DomainStartEndE-ValueType
Pfam:LUC7 1 300 7.9e-72 PFAM
Meta Mutation Damage Score 0.0980 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 96% (51/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with an N-terminal half that contains cysteine/histidine motifs and leucine zipper-like repeats, and the C-terminal half is rich in arginine and glutamate residues (RE domain) and arginine and serine residues (RS domain). This protein localizes with a speckled pattern in the nucleus, and could be involved in the formation of splicesome via the RE and RS domains. Two alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Aug 2009]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik G A 19: 5,503,411 P114L probably benign Het
4930539E08Rik G A 17: 28,905,324 R335W probably damaging Het
9530053A07Rik T A 7: 28,144,256 C856* probably null Het
Acss2 G A 2: 155,574,690 probably null Het
Adamts10 G A 17: 33,531,616 R210H probably benign Het
Als2 T C 1: 59,167,616 probably null Het
Aplp2 A T 9: 31,152,356 M652K possibly damaging Het
Atrn A G 2: 130,961,571 I560M possibly damaging Het
Bicc1 T C 10: 70,946,604 D602G possibly damaging Het
Cdh4 A G 2: 179,444,810 probably null Het
Clasp1 T A 1: 118,542,997 probably null Het
Col6a6 A G 9: 105,767,324 I1255T probably damaging Het
Comp G T 8: 70,381,350 V672L probably damaging Het
Dbnl T G 11: 5,795,486 D122E probably damaging Het
Dgkz G A 2: 91,942,675 R346C probably damaging Het
Dnhd1 C T 7: 105,678,309 R54C probably damaging Het
Elmo3 T C 8: 105,306,714 I121T probably damaging Het
Fam184b A G 5: 45,542,232 L614P probably damaging Het
Fbxo18 T C 2: 11,749,537 R797G probably benign Het
Gata6 A G 18: 11,059,108 T392A probably damaging Het
Gm17783 T A 16: 45,528,492 T106S possibly damaging Het
Gm21731 A T 13: 120,240,979 M104L probably benign Het
Gm29609 A G 5: 31,154,232 F855S probably benign Het
Gm3424 T C 14: 5,829,330 N88D possibly damaging Het
Gnas T A 2: 174,298,099 S80T unknown Het
Hsd17b14 C A 7: 45,566,146 P190Q probably damaging Het
Iqch C T 9: 63,445,521 V955I possibly damaging Het
Kcnt2 T C 1: 140,376,384 V164A probably benign Het
Krt87 A G 15: 101,438,634 L46P probably damaging Het
Lef1 A G 3: 131,191,099 M237V probably benign Het
Lmbr1l A T 15: 98,909,386 probably null Het
Lrrc49 T C 9: 60,610,403 I408V probably damaging Het
March2 A T 17: 33,703,058 C109* probably null Het
Metrnl T A 11: 121,715,970 C284S probably damaging Het
Mmachc G A 4: 116,705,885 T91I probably benign Het
Mrps7 T G 11: 115,606,870 M187R probably damaging Het
Ncapd3 A G 9: 27,067,040 E845G probably damaging Het
Olfr1393 T A 11: 49,280,333 F62I probably damaging Het
Olfr272 A T 4: 52,911,376 D139E probably benign Het
Ooep T A 9: 78,378,065 T90S possibly damaging Het
Pcdhb18 A T 18: 37,491,609 D664V probably damaging Het
Pigz T C 16: 31,945,131 S336P probably benign Het
Pou2f2 A T 7: 25,116,128 D71E probably benign Het
Reep6 G T 10: 80,335,199 R303L possibly damaging Het
Rmdn2 A T 17: 79,627,868 S137C Het
Rnf220 A T 4: 117,489,930 L95H probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,911 probably benign Het
Stxbp1 A T 2: 32,818,505 S83T probably damaging Het
Trappc11 T C 8: 47,505,582 probably null Het
Ttn G T 2: 76,791,301 D15598E probably damaging Het
Vav2 T A 2: 27,275,002 R645W probably damaging Het
Vmn1r169 T A 7: 23,577,987 V268D probably benign Het
Zp2 A T 7: 120,136,056 C365S probably damaging Het
Other mutations in Luc7l3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00832:Luc7l3 APN 11 94303942 missense probably benign 0.43
IGL02138:Luc7l3 APN 11 94303966 missense probably benign 0.00
IGL02318:Luc7l3 APN 11 94292993 missense probably benign 0.05
IGL02479:Luc7l3 APN 11 94296909 unclassified probably benign
IGL02563:Luc7l3 APN 11 94300068 splice site probably null
veritas UTSW 11 94292953 missense probably damaging 0.98
R0096:Luc7l3 UTSW 11 94301494 splice site probably benign
R0096:Luc7l3 UTSW 11 94301494 splice site probably benign
R1706:Luc7l3 UTSW 11 94297756 splice site probably benign
R3803:Luc7l3 UTSW 11 94293166 utr 3 prime probably benign
R4260:Luc7l3 UTSW 11 94296050 unclassified probably benign
R4647:Luc7l3 UTSW 11 94309641 missense probably damaging 1.00
R5153:Luc7l3 UTSW 11 94295980 unclassified probably benign
R5179:Luc7l3 UTSW 11 94300053 missense possibly damaging 0.92
R5591:Luc7l3 UTSW 11 94293234 unclassified probably benign
R6767:Luc7l3 UTSW 11 94292953 missense probably damaging 0.98
R6912:Luc7l3 UTSW 11 94309636 missense probably damaging 0.97
R7168:Luc7l3 UTSW 11 94299984 missense unknown
Z1177:Luc7l3 UTSW 11 94321775 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GCTCAAGCTCAGAAAGTCTTTAAG -3'
(R):5'- GATTCTCTGAGCCCTTTTAGTAATACC -3'

Sequencing Primer
(F):5'- CTTTAAGACGGTCAGGCTGGC -3'
(R):5'- GAGCCCTTTTAGTAATACCAGCTG -3'
Posted On2019-10-17