Incidental Mutation 'R7541:Pigz'
ID583910
Institutional Source Beutler Lab
Gene Symbol Pigz
Ensembl Gene ENSMUSG00000045625
Gene Namephosphatidylinositol glycan anchor biosynthesis, class Z
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7541 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location31933851-31946046 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31945131 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 336 (S336P)
Ref Sequence ENSEMBL: ENSMUSP00000057509 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023460] [ENSMUST00000052174] [ENSMUST00000126215] [ENSMUST00000134666] [ENSMUST00000134928] [ENSMUST00000151412] [ENSMUST00000202722]
Predicted Effect probably benign
Transcript: ENSMUST00000023460
SMART Domains Protein: ENSMUSP00000023460
Gene: ENSMUSG00000022774

DomainStartEndE-ValueType
RRM 41 114 6.96e-23 SMART
low complexity region 122 135 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000052174
AA Change: S336P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000057509
Gene: ENSMUSG00000045625
AA Change: S336P

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 7 446 1.3e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126215
Predicted Effect probably benign
Transcript: ENSMUST00000134666
Predicted Effect probably benign
Transcript: ENSMUST00000134928
Predicted Effect probably benign
Transcript: ENSMUST00000151412
Predicted Effect probably benign
Transcript: ENSMUST00000202722
SMART Domains Protein: ENSMUSP00000143811
Gene: ENSMUSG00000107002

DomainStartEndE-ValueType
low complexity region 27 43 N/A INTRINSIC
low complexity region 47 55 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 96% (51/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The glycosylphosphatidylinositol (GPI) anchor is a glycolipid found on many blood cells that serves to anchor proteins to the cell surface. This gene encodes a protein that is localized to the endoplasmic reticulum, and is involved in GPI anchor biosynthesis. As shown for the yeast homolog, which is a member of a family of dolichol-phosphate-mannose (Dol-P-Man)-dependent mannosyltransferases, this protein can also add a side-branching fourth mannose to GPI precursors during the assembly of GPI anchors. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik G A 19: 5,503,411 P114L probably benign Het
4930539E08Rik G A 17: 28,905,324 R335W probably damaging Het
9530053A07Rik T A 7: 28,144,256 C856* probably null Het
Acss2 G A 2: 155,574,690 probably null Het
Adamts10 G A 17: 33,531,616 R210H probably benign Het
Als2 T C 1: 59,167,616 probably null Het
Aplp2 A T 9: 31,152,356 M652K possibly damaging Het
Atrn A G 2: 130,961,571 I560M possibly damaging Het
Bicc1 T C 10: 70,946,604 D602G possibly damaging Het
Cdh4 A G 2: 179,444,810 probably null Het
Clasp1 T A 1: 118,542,997 probably null Het
Col6a6 A G 9: 105,767,324 I1255T probably damaging Het
Comp G T 8: 70,381,350 V672L probably damaging Het
Dbnl T G 11: 5,795,486 D122E probably damaging Het
Dgkz G A 2: 91,942,675 R346C probably damaging Het
Dnhd1 C T 7: 105,678,309 R54C probably damaging Het
Elmo3 T C 8: 105,306,714 I121T probably damaging Het
Fam184b A G 5: 45,542,232 L614P probably damaging Het
Fbxo18 T C 2: 11,749,537 R797G probably benign Het
Gata6 A G 18: 11,059,108 T392A probably damaging Het
Gm17783 T A 16: 45,528,492 T106S possibly damaging Het
Gm21731 A T 13: 120,240,979 M104L probably benign Het
Gm29609 A G 5: 31,154,232 F855S probably benign Het
Gm3424 T C 14: 5,829,330 N88D possibly damaging Het
Gnas T A 2: 174,298,099 S80T unknown Het
Hsd17b14 C A 7: 45,566,146 P190Q probably damaging Het
Iqch C T 9: 63,445,521 V955I possibly damaging Het
Kcnt2 T C 1: 140,376,384 V164A probably benign Het
Krt87 A G 15: 101,438,634 L46P probably damaging Het
Lef1 A G 3: 131,191,099 M237V probably benign Het
Lmbr1l A T 15: 98,909,386 probably null Het
Lrrc49 T C 9: 60,610,403 I408V probably damaging Het
Luc7l3 T C 11: 94,295,965 S365G unknown Het
March2 A T 17: 33,703,058 C109* probably null Het
Metrnl T A 11: 121,715,970 C284S probably damaging Het
Mmachc G A 4: 116,705,885 T91I probably benign Het
Mrps7 T G 11: 115,606,870 M187R probably damaging Het
Ncapd3 A G 9: 27,067,040 E845G probably damaging Het
Olfr1393 T A 11: 49,280,333 F62I probably damaging Het
Olfr272 A T 4: 52,911,376 D139E probably benign Het
Ooep T A 9: 78,378,065 T90S possibly damaging Het
Pcdhb18 A T 18: 37,491,609 D664V probably damaging Het
Pou2f2 A T 7: 25,116,128 D71E probably benign Het
Reep6 G T 10: 80,335,199 R303L possibly damaging Het
Rmdn2 A T 17: 79,627,868 S137C Het
Rnf220 A T 4: 117,489,930 L95H probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,911 probably benign Het
Stxbp1 A T 2: 32,818,505 S83T probably damaging Het
Trappc11 T C 8: 47,505,582 probably null Het
Ttn G T 2: 76,791,301 D15598E probably damaging Het
Vav2 T A 2: 27,275,002 R645W probably damaging Het
Vmn1r169 T A 7: 23,577,987 V268D probably benign Het
Zp2 A T 7: 120,136,056 C365S probably damaging Het
Other mutations in Pigz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02697:Pigz APN 16 31944759 splice site probably null
IGL02963:Pigz APN 16 31944535 missense probably damaging 0.99
lust UTSW 16 31944937 missense probably damaging 1.00
R0884:Pigz UTSW 16 31941976 splice site probably null
R1252:Pigz UTSW 16 31941990 missense possibly damaging 0.49
R1776:Pigz UTSW 16 31944579 missense probably damaging 0.99
R4744:Pigz UTSW 16 31945333 missense probably damaging 1.00
R5480:Pigz UTSW 16 31944621 missense probably damaging 0.97
R5793:Pigz UTSW 16 31945467 missense probably benign 0.00
R5905:Pigz UTSW 16 31945428 missense probably benign 0.26
R6025:Pigz UTSW 16 31945710 missense probably damaging 1.00
R6251:Pigz UTSW 16 31945606 missense possibly damaging 0.94
R6297:Pigz UTSW 16 31944937 missense probably damaging 1.00
R6735:Pigz UTSW 16 31945543 missense probably benign 0.01
R6770:Pigz UTSW 16 31945750 missense probably damaging 1.00
R6855:Pigz UTSW 16 31945218 missense possibly damaging 0.85
R8080:Pigz UTSW 16 31942040 missense probably damaging 1.00
Z1177:Pigz UTSW 16 31944525 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTGTACTACAACCTGGACCCC -3'
(R):5'- CCTGATGCAGGCAACCAAAG -3'

Sequencing Primer
(F):5'- TGGACCCCCAAAACCTTGC -3'
(R):5'- TGAGAGCGCCCAGGATGTTG -3'
Posted On2019-10-17