Incidental Mutation 'R7541:Adamts10'
ID 583913
Institutional Source Beutler Lab
Gene Symbol Adamts10
Ensembl Gene ENSMUSG00000024299
Gene Name a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 10
Synonyms ZnMP
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.205) question?
Stock # R7541 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 33524204-33553782 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 33531616 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 210 (R210H)
Ref Sequence ENSEMBL: ENSMUSP00000084905 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087623] [ENSMUST00000172922] [ENSMUST00000173013] [ENSMUST00000173030] [ENSMUST00000173241] [ENSMUST00000173931]
AlphaFold P58459
Predicted Effect probably benign
Transcript: ENSMUST00000087623
AA Change: R210H

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000084905
Gene: ENSMUSG00000024299
AA Change: R210H

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Pep_M12B_propep 40 180 1.3e-33 PFAM
Pfam:Reprolysin_5 237 432 5e-15 PFAM
Pfam:Reprolysin_4 237 448 5e-11 PFAM
Pfam:Reprolysin 239 457 1.6e-25 PFAM
Pfam:Reprolysin_2 257 447 1.2e-13 PFAM
Pfam:Reprolysin_3 261 403 5.7e-13 PFAM
TSP1 550 602 7.21e-11 SMART
Pfam:ADAM_spacer1 706 818 1.3e-27 PFAM
TSP1 828 885 4.73e-6 SMART
TSP1 887 940 4.35e-2 SMART
TSP1 948 1003 2.66e-2 SMART
TSP1 1006 1058 9.98e-5 SMART
Pfam:PLAC 1070 1102 8.4e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000172922
AA Change: R210H

PolyPhen 2 Score 0.554 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000133891
Gene: ENSMUSG00000024299
AA Change: R210H

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Pep_M12B_propep 39 180 1.1e-30 PFAM
SCOP:d1bkca_ 238 271 4e-7 SMART
low complexity region 285 296 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173013
AA Change: R210H

PolyPhen 2 Score 0.282 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000134181
Gene: ENSMUSG00000024299
AA Change: R210H

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Pep_M12B_propep 39 180 9.6e-31 PFAM
SCOP:d1bkca_ 238 271 3e-7 SMART
low complexity region 285 296 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173030
AA Change: R210H

PolyPhen 2 Score 0.282 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000134549
Gene: ENSMUSG00000024299
AA Change: R210H

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Pep_M12B_propep 39 180 9.6e-31 PFAM
SCOP:d1bkca_ 238 271 3e-7 SMART
low complexity region 285 296 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173241
AA Change: R210H

PolyPhen 2 Score 0.282 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000134298
Gene: ENSMUSG00000024299
AA Change: R210H

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Pep_M12B_propep 39 180 9.6e-31 PFAM
SCOP:d1bkca_ 238 271 3e-7 SMART
low complexity region 285 296 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173931
AA Change: R210H

PolyPhen 2 Score 0.282 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000133434
Gene: ENSMUSG00000024299
AA Change: R210H

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Pep_M12B_propep 39 180 9.6e-31 PFAM
SCOP:d1bkca_ 238 271 3e-7 SMART
low complexity region 285 296 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174348
SMART Domains Protein: ENSMUSP00000133856
Gene: ENSMUSG00000024299

DomainStartEndE-ValueType
Pfam:Reprolysin_5 23 220 2.6e-16 PFAM
Pfam:Reprolysin_4 23 235 2.6e-12 PFAM
Pfam:Reprolysin 25 243 1e-26 PFAM
Pfam:Reprolysin_2 43 233 7.1e-15 PFAM
Pfam:Reprolysin_3 47 189 4.7e-14 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 96% (51/53)
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate a functional, zinc-dependent metallopeptidase enzyme. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik G A 19: 5,503,411 P114L probably benign Het
4930539E08Rik G A 17: 28,905,324 R335W probably damaging Het
9530053A07Rik T A 7: 28,144,256 C856* probably null Het
Acss2 G A 2: 155,574,690 probably null Het
Als2 T C 1: 59,167,616 probably null Het
Aplp2 A T 9: 31,152,356 M652K possibly damaging Het
Atrn A G 2: 130,961,571 I560M possibly damaging Het
Bicc1 T C 10: 70,946,604 D602G possibly damaging Het
Cdh4 A G 2: 179,444,810 probably null Het
Clasp1 T A 1: 118,542,997 probably null Het
Col6a6 A G 9: 105,767,324 I1255T probably damaging Het
Comp G T 8: 70,381,350 V672L probably damaging Het
Dbnl T G 11: 5,795,486 D122E probably damaging Het
Dgkz G A 2: 91,942,675 R346C probably damaging Het
Dnhd1 C T 7: 105,678,309 R54C probably damaging Het
Elmo3 T C 8: 105,306,714 I121T probably damaging Het
Fam184b A G 5: 45,542,232 L614P probably damaging Het
Fbxo18 T C 2: 11,749,537 R797G probably benign Het
Gata6 A G 18: 11,059,108 T392A probably damaging Het
Gm17783 T A 16: 45,528,492 T106S possibly damaging Het
Gm21731 A T 13: 120,240,979 M104L probably benign Het
Gm29609 A G 5: 31,154,232 F855S probably benign Het
Gm3424 T C 14: 5,829,330 N88D possibly damaging Het
Gnas T A 2: 174,298,099 S80T unknown Het
Hsd17b14 C A 7: 45,566,146 P190Q probably damaging Het
Iqch C T 9: 63,445,521 V955I possibly damaging Het
Kcnt2 T C 1: 140,376,384 V164A probably benign Het
Krt87 A G 15: 101,438,634 L46P probably damaging Het
Lef1 A G 3: 131,191,099 M237V probably benign Het
Lmbr1l A T 15: 98,909,386 probably null Het
Lrrc49 T C 9: 60,610,403 I408V probably damaging Het
Luc7l3 T C 11: 94,295,965 S365G unknown Het
March2 A T 17: 33,703,058 C109* probably null Het
Metrnl T A 11: 121,715,970 C284S probably damaging Het
Mmachc G A 4: 116,705,885 T91I probably benign Het
Mrps7 T G 11: 115,606,870 M187R probably damaging Het
Ncapd3 A G 9: 27,067,040 E845G probably damaging Het
Olfr1393 T A 11: 49,280,333 F62I probably damaging Het
Olfr272 A T 4: 52,911,376 D139E probably benign Het
Ooep T A 9: 78,378,065 T90S possibly damaging Het
Pcdhb18 A T 18: 37,491,609 D664V probably damaging Het
Pigz T C 16: 31,945,131 S336P probably benign Het
Pou2f2 A T 7: 25,116,128 D71E probably benign Het
Reep6 G T 10: 80,335,199 R303L possibly damaging Het
Rmdn2 A T 17: 79,627,868 S137C Het
Rnf220 A T 4: 117,489,930 L95H probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,911 probably benign Het
Stxbp1 A T 2: 32,818,505 S83T probably damaging Het
Trappc11 T C 8: 47,505,582 probably null Het
Ttn G T 2: 76,791,301 D15598E probably damaging Het
Vav2 T A 2: 27,275,002 R645W probably damaging Het
Vmn1r169 T A 7: 23,577,987 V268D probably benign Het
Zp2 A T 7: 120,136,056 C365S probably damaging Het
Other mutations in Adamts10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01541:Adamts10 APN 17 33543231 missense probably benign 0.24
IGL01865:Adamts10 APN 17 33553166 missense probably damaging 0.99
IGL02391:Adamts10 APN 17 33528811 missense probably benign 0.00
IGL02711:Adamts10 APN 17 33538272 missense probably damaging 0.99
R0122:Adamts10 UTSW 17 33528480 unclassified probably benign
R0207:Adamts10 UTSW 17 33545390 missense possibly damaging 0.64
R0481:Adamts10 UTSW 17 33549373 nonsense probably null
R0508:Adamts10 UTSW 17 33543718 missense probably damaging 1.00
R0558:Adamts10 UTSW 17 33550609 missense probably benign 0.04
R0746:Adamts10 UTSW 17 33549547 nonsense probably null
R1027:Adamts10 UTSW 17 33543763 missense probably benign 0.44
R1449:Adamts10 UTSW 17 33545639 missense probably damaging 0.96
R1471:Adamts10 UTSW 17 33553138 missense probably damaging 1.00
R1522:Adamts10 UTSW 17 33537319 missense probably benign 0.40
R1631:Adamts10 UTSW 17 33537342 missense probably benign 0.25
R1863:Adamts10 UTSW 17 33551432 critical splice donor site probably null
R1913:Adamts10 UTSW 17 33549555 missense probably benign 0.00
R2091:Adamts10 UTSW 17 33551192 critical splice donor site probably null
R2377:Adamts10 UTSW 17 33528892 missense probably damaging 1.00
R3743:Adamts10 UTSW 17 33528712 missense probably damaging 1.00
R4042:Adamts10 UTSW 17 33549540 missense possibly damaging 0.69
R4646:Adamts10 UTSW 17 33545555 missense probably damaging 1.00
R4654:Adamts10 UTSW 17 33537330 missense possibly damaging 0.89
R4695:Adamts10 UTSW 17 33531739 missense possibly damaging 0.95
R4721:Adamts10 UTSW 17 33545537 splice site probably null
R4798:Adamts10 UTSW 17 33528752 missense probably damaging 1.00
R4896:Adamts10 UTSW 17 33528896 missense possibly damaging 0.90
R7454:Adamts10 UTSW 17 33545005 missense possibly damaging 0.89
R7494:Adamts10 UTSW 17 33549378 nonsense probably null
R7704:Adamts10 UTSW 17 33551152 missense probably damaging 1.00
R7955:Adamts10 UTSW 17 33545639 missense probably damaging 0.96
R8154:Adamts10 UTSW 17 33537928 missense probably damaging 1.00
R8895:Adamts10 UTSW 17 33549296 missense probably damaging 1.00
R8986:Adamts10 UTSW 17 33543694 missense probably benign 0.09
R9116:Adamts10 UTSW 17 33537356 missense probably benign 0.31
Z1176:Adamts10 UTSW 17 33528787 missense probably damaging 1.00
Z1176:Adamts10 UTSW 17 33528788 missense probably damaging 1.00
Z1177:Adamts10 UTSW 17 33545429 missense possibly damaging 0.76
Z1177:Adamts10 UTSW 17 33545594 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCATGTGAAGTATGTATGGCAAC -3'
(R):5'- TGGCCAACACATACTGCTC -3'

Sequencing Primer
(F):5'- TCATCAATGTACTTGGAAAGTAGAGG -3'
(R):5'- ACACATACTGCTCCACATCTCTC -3'
Posted On 2019-10-17