Incidental Mutation 'R7541:March2'
ID583914
Institutional Source Beutler Lab
Gene Symbol March2
Ensembl Gene ENSMUSG00000079557
Gene Namemembrane-associated ring finger (C3HC4) 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R7541 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location33685692-33718670 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 33703058 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 109 (C109*)
Ref Sequence ENSEMBL: ENSMUSP00000065225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066121] [ENSMUST00000167611] [ENSMUST00000172767] [ENSMUST00000172934] [ENSMUST00000173015] [ENSMUST00000173329] [ENSMUST00000173392] [ENSMUST00000173454] [ENSMUST00000174040] [ENSMUST00000186022]
Predicted Effect probably null
Transcript: ENSMUST00000066121
AA Change: C109*
SMART Domains Protein: ENSMUSP00000065225
Gene: ENSMUSG00000079557
AA Change: C109*

DomainStartEndE-ValueType
RINGv 63 110 2.86e-23 SMART
transmembrane domain 143 160 N/A INTRINSIC
transmembrane domain 175 197 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000167611
AA Change: C109*
SMART Domains Protein: ENSMUSP00000127601
Gene: ENSMUSG00000079557
AA Change: C109*

DomainStartEndE-ValueType
RINGv 63 110 2.86e-23 SMART
transmembrane domain 143 160 N/A INTRINSIC
transmembrane domain 175 197 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000172767
AA Change: C109*
SMART Domains Protein: ENSMUSP00000134220
Gene: ENSMUSG00000079557
AA Change: C109*

DomainStartEndE-ValueType
RINGv 63 110 2.86e-23 SMART
transmembrane domain 143 160 N/A INTRINSIC
transmembrane domain 175 197 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000172934
AA Change: C109*
SMART Domains Protein: ENSMUSP00000134026
Gene: ENSMUSG00000079557
AA Change: C109*

DomainStartEndE-ValueType
RINGv 63 110 2.86e-23 SMART
transmembrane domain 142 161 N/A INTRINSIC
transmembrane domain 176 195 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000173015
AA Change: C109*
SMART Domains Protein: ENSMUSP00000133802
Gene: ENSMUSG00000079557
AA Change: C109*

DomainStartEndE-ValueType
RINGv 63 110 2.86e-23 SMART
transmembrane domain 142 164 N/A INTRINSIC
transmembrane domain 179 201 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000173329
AA Change: C109*
SMART Domains Protein: ENSMUSP00000133825
Gene: ENSMUSG00000079557
AA Change: C109*

DomainStartEndE-ValueType
RINGv 63 110 2.86e-23 SMART
transmembrane domain 142 164 N/A INTRINSIC
transmembrane domain 174 196 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173392
SMART Domains Protein: ENSMUSP00000134255
Gene: ENSMUSG00000079557

DomainStartEndE-ValueType
Blast:RINGv 63 82 6e-7 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000173454
AA Change: C48*
SMART Domains Protein: ENSMUSP00000133940
Gene: ENSMUSG00000079557
AA Change: C48*

DomainStartEndE-ValueType
RINGv 2 49 2.86e-23 SMART
transmembrane domain 82 99 N/A INTRINSIC
transmembrane domain 114 136 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000174040
AA Change: C129*
SMART Domains Protein: ENSMUSP00000134437
Gene: ENSMUSG00000079557
AA Change: C129*

DomainStartEndE-ValueType
RINGv 83 130 2.86e-23 SMART
transmembrane domain 158 180 N/A INTRINSIC
transmembrane domain 193 215 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000186022
AA Change: C109*
SMART Domains Protein: ENSMUSP00000139724
Gene: ENSMUSG00000079557
AA Change: C109*

DomainStartEndE-ValueType
RINGv 63 110 2.86e-23 SMART
transmembrane domain 143 160 N/A INTRINSIC
transmembrane domain 175 197 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 96% (51/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MARCH2 is a member of the MARCH family of membrane-bound E3 ubiquitin ligases (EC 6.3.2.19). MARCH enzymes add ubiquitin (see MIM 191339) to target lysines in substrate proteins, thereby signaling their vesicular transport between membrane compartments. MARCH2 reduces surface accumulation of several glycoproteins and appears to regulate early endosome-to-trans-Golgi network (TGN) trafficking (Bartee et al., 2004 [PubMed 14722266]; Nakamura et al., 2005 [PubMed 15689499]).[supplied by OMIM, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik G A 19: 5,503,411 P114L probably benign Het
4930539E08Rik G A 17: 28,905,324 R335W probably damaging Het
9530053A07Rik T A 7: 28,144,256 C856* probably null Het
Acss2 G A 2: 155,574,690 probably null Het
Adamts10 G A 17: 33,531,616 R210H probably benign Het
Als2 T C 1: 59,167,616 probably null Het
Aplp2 A T 9: 31,152,356 M652K possibly damaging Het
Atrn A G 2: 130,961,571 I560M possibly damaging Het
Bicc1 T C 10: 70,946,604 D602G possibly damaging Het
Cdh4 A G 2: 179,444,810 probably null Het
Clasp1 T A 1: 118,542,997 probably null Het
Col6a6 A G 9: 105,767,324 I1255T probably damaging Het
Comp G T 8: 70,381,350 V672L probably damaging Het
Dbnl T G 11: 5,795,486 D122E probably damaging Het
Dgkz G A 2: 91,942,675 R346C probably damaging Het
Dnhd1 C T 7: 105,678,309 R54C probably damaging Het
Elmo3 T C 8: 105,306,714 I121T probably damaging Het
Fam184b A G 5: 45,542,232 L614P probably damaging Het
Fbxo18 T C 2: 11,749,537 R797G probably benign Het
Gata6 A G 18: 11,059,108 T392A probably damaging Het
Gm17783 T A 16: 45,528,492 T106S possibly damaging Het
Gm21731 A T 13: 120,240,979 M104L probably benign Het
Gm29609 A G 5: 31,154,232 F855S probably benign Het
Gm3424 T C 14: 5,829,330 N88D possibly damaging Het
Gnas T A 2: 174,298,099 S80T unknown Het
Hsd17b14 C A 7: 45,566,146 P190Q probably damaging Het
Iqch C T 9: 63,445,521 V955I possibly damaging Het
Kcnt2 T C 1: 140,376,384 V164A probably benign Het
Krt87 A G 15: 101,438,634 L46P probably damaging Het
Lef1 A G 3: 131,191,099 M237V probably benign Het
Lmbr1l A T 15: 98,909,386 probably null Het
Lrrc49 T C 9: 60,610,403 I408V probably damaging Het
Luc7l3 T C 11: 94,295,965 S365G unknown Het
Metrnl T A 11: 121,715,970 C284S probably damaging Het
Mmachc G A 4: 116,705,885 T91I probably benign Het
Mrps7 T G 11: 115,606,870 M187R probably damaging Het
Ncapd3 A G 9: 27,067,040 E845G probably damaging Het
Olfr1393 T A 11: 49,280,333 F62I probably damaging Het
Olfr272 A T 4: 52,911,376 D139E probably benign Het
Ooep T A 9: 78,378,065 T90S possibly damaging Het
Pcdhb18 A T 18: 37,491,609 D664V probably damaging Het
Pigz T C 16: 31,945,131 S336P probably benign Het
Pou2f2 A T 7: 25,116,128 D71E probably benign Het
Reep6 G T 10: 80,335,199 R303L possibly damaging Het
Rmdn2 A T 17: 79,627,868 S137C Het
Rnf220 A T 4: 117,489,930 L95H probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,911 probably benign Het
Stxbp1 A T 2: 32,818,505 S83T probably damaging Het
Trappc11 T C 8: 47,505,582 probably null Het
Ttn G T 2: 76,791,301 D15598E probably damaging Het
Vav2 T A 2: 27,275,002 R645W probably damaging Het
Vmn1r169 T A 7: 23,577,987 V268D probably benign Het
Zp2 A T 7: 120,136,056 C365S probably damaging Het
Other mutations in March2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01668:March2 APN 17 33703096 missense probably damaging 1.00
IGL02562:March2 APN 17 33696074 missense probably damaging 1.00
R1022:March2 UTSW 17 33709788 missense probably damaging 1.00
R1024:March2 UTSW 17 33709788 missense probably damaging 1.00
R1398:March2 UTSW 17 33696122 missense probably damaging 1.00
R4384:March2 UTSW 17 33696193 missense probably benign 0.34
R4760:March2 UTSW 17 33709916 missense probably damaging 1.00
R4776:March2 UTSW 17 33709916 missense probably damaging 1.00
R8856:March2 UTSW 17 33696191 missense probably benign 0.42
Predicted Primers PCR Primer
(F):5'- AAATCCCTCCCAGCATTGG -3'
(R):5'- GCTTGTAACCTAGCAAGTGC -3'

Sequencing Primer
(F):5'- GCATTGGCGGGGACATAATC -3'
(R):5'- CTGATGTTAGTCTAAACAAGGAACCG -3'
Posted On2019-10-17