Incidental Mutation 'R7541:Gata6'
ID583916
Institutional Source Beutler Lab
Gene Symbol Gata6
Ensembl Gene ENSMUSG00000005836
Gene NameGATA binding protein 6
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7541 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location11052508-11085635 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 11059108 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 392 (T392A)
Ref Sequence ENSEMBL: ENSMUSP00000041774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047762]
Predicted Effect probably damaging
Transcript: ENSMUST00000047762
AA Change: T392A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000041774
Gene: ENSMUSG00000005836
AA Change: T392A

DomainStartEndE-ValueType
low complexity region 14 29 N/A INTRINSIC
low complexity region 32 47 N/A INTRINSIC
low complexity region 84 105 N/A INTRINSIC
Pfam:GATA-N 147 372 2.3e-62 PFAM
ZnF_GATA 378 429 4.23e-16 SMART
ZnF_GATA 432 482 3.62e-24 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 96% (51/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a small family of zinc finger transcription factors that play an important role in the regulation of cellular differentiation and organogenesis during vertebrate development. This gene is expressed during early embryogenesis and localizes to endo- and mesodermally derived cells during later embryogenesis and thereby plays an important role in gut, lung, and heart development. Mutations in this gene are associated with several congenital defects. [provided by RefSeq, Mar 2012]
PHENOTYPE: Homozygous null mutant E5.5 embryos lack parts of the visceral endoderm, show impaired embryonic ectoderm development, and die soon post-implantation, apparently of extraembryonic tissue defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik G A 19: 5,503,411 P114L probably benign Het
4930539E08Rik G A 17: 28,905,324 R335W probably damaging Het
9530053A07Rik T A 7: 28,144,256 C856* probably null Het
Acss2 G A 2: 155,574,690 probably null Het
Adamts10 G A 17: 33,531,616 R210H probably benign Het
Als2 T C 1: 59,167,616 probably null Het
Aplp2 A T 9: 31,152,356 M652K possibly damaging Het
Atrn A G 2: 130,961,571 I560M possibly damaging Het
Bicc1 T C 10: 70,946,604 D602G possibly damaging Het
Cdh4 A G 2: 179,444,810 probably null Het
Clasp1 T A 1: 118,542,997 probably null Het
Col6a6 A G 9: 105,767,324 I1255T probably damaging Het
Comp G T 8: 70,381,350 V672L probably damaging Het
Dbnl T G 11: 5,795,486 D122E probably damaging Het
Dgkz G A 2: 91,942,675 R346C probably damaging Het
Dnhd1 C T 7: 105,678,309 R54C probably damaging Het
Elmo3 T C 8: 105,306,714 I121T probably damaging Het
Fam184b A G 5: 45,542,232 L614P probably damaging Het
Fbxo18 T C 2: 11,749,537 R797G probably benign Het
Gm17783 T A 16: 45,528,492 T106S possibly damaging Het
Gm21731 A T 13: 120,240,979 M104L probably benign Het
Gm29609 A G 5: 31,154,232 F855S probably benign Het
Gm3424 T C 14: 5,829,330 N88D possibly damaging Het
Gnas T A 2: 174,298,099 S80T unknown Het
Hsd17b14 C A 7: 45,566,146 P190Q probably damaging Het
Iqch C T 9: 63,445,521 V955I possibly damaging Het
Kcnt2 T C 1: 140,376,384 V164A probably benign Het
Krt87 A G 15: 101,438,634 L46P probably damaging Het
Lef1 A G 3: 131,191,099 M237V probably benign Het
Lmbr1l A T 15: 98,909,386 probably null Het
Lrrc49 T C 9: 60,610,403 I408V probably damaging Het
Luc7l3 T C 11: 94,295,965 S365G unknown Het
March2 A T 17: 33,703,058 C109* probably null Het
Metrnl T A 11: 121,715,970 C284S probably damaging Het
Mmachc G A 4: 116,705,885 T91I probably benign Het
Mrps7 T G 11: 115,606,870 M187R probably damaging Het
Ncapd3 A G 9: 27,067,040 E845G probably damaging Het
Olfr1393 T A 11: 49,280,333 F62I probably damaging Het
Olfr272 A T 4: 52,911,376 D139E probably benign Het
Ooep T A 9: 78,378,065 T90S possibly damaging Het
Pcdhb18 A T 18: 37,491,609 D664V probably damaging Het
Pigz T C 16: 31,945,131 S336P probably benign Het
Pou2f2 A T 7: 25,116,128 D71E probably benign Het
Reep6 G T 10: 80,335,199 R303L possibly damaging Het
Rmdn2 A T 17: 79,627,868 S137C Het
Rnf220 A T 4: 117,489,930 L95H probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,911 probably benign Het
Stxbp1 A T 2: 32,818,505 S83T probably damaging Het
Trappc11 T C 8: 47,505,582 probably null Het
Ttn G T 2: 76,791,301 D15598E probably damaging Het
Vav2 T A 2: 27,275,002 R645W probably damaging Het
Vmn1r169 T A 7: 23,577,987 V268D probably benign Het
Zp2 A T 7: 120,136,056 C365S probably damaging Het
Other mutations in Gata6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00567:Gata6 APN 18 11084330 missense possibly damaging 0.47
IGL01328:Gata6 APN 18 11064530 missense probably damaging 0.99
IGL02419:Gata6 APN 18 11054220 missense probably damaging 1.00
lutsen UTSW 18 11063059 missense possibly damaging 0.65
R0538:Gata6 UTSW 18 11064771 missense probably benign 0.11
R1419:Gata6 UTSW 18 11064706 missense probably benign 0.42
R2000:Gata6 UTSW 18 11054113 missense probably benign 0.04
R3113:Gata6 UTSW 18 11063124 missense probably damaging 1.00
R4765:Gata6 UTSW 18 11054394 missense probably benign
R4855:Gata6 UTSW 18 11054497 missense possibly damaging 0.92
R5368:Gata6 UTSW 18 11063059 missense possibly damaging 0.65
R6805:Gata6 UTSW 18 11054460 missense possibly damaging 0.83
R7192:Gata6 UTSW 18 11054475 missense possibly damaging 0.82
R7206:Gata6 UTSW 18 11054850 missense probably damaging 1.00
R7501:Gata6 UTSW 18 11054082 missense probably damaging 0.97
R7736:Gata6 UTSW 18 11084379 missense probably damaging 1.00
R8029:Gata6 UTSW 18 11054944 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- TGGGGTTTCTACTAGACCCC -3'
(R):5'- GGATTCTGACACGCGCTAAAG -3'

Sequencing Primer
(F):5'- ACAGTGGCCAGCGGATCTAG -3'
(R):5'- TGACACGCGCTAAAGGAGGTG -3'
Posted On2019-10-17