Incidental Mutation 'R7541:1700020D05Rik'
ID 583918
Institutional Source Beutler Lab
Gene Symbol 1700020D05Rik
Ensembl Gene ENSMUSG00000100937
Gene Name RIKEN cDNA 1700020D05 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock # R7541 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 5502767-5503787 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 5503411 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 114 (P114L)
Ref Sequence ENSEMBL: ENSMUSP00000140922 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070172] [ENSMUST00000189704]
AlphaFold Q99PB1
Predicted Effect probably benign
Transcript: ENSMUST00000070172
SMART Domains Protein: ENSMUSP00000070915
Gene: ENSMUSG00000056185

DomainStartEndE-ValueType
Pfam:PX 24 165 1.4e-19 PFAM
Pfam:Vps5 183 394 9.9e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189704
AA Change: P114L

PolyPhen 2 Score 0.398 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000140922
Gene: ENSMUSG00000100937
AA Change: P114L

DomainStartEndE-ValueType
Pfam:MAGE 82 253 2.2e-57 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 96% (51/53)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930539E08Rik G A 17: 28,905,324 R335W probably damaging Het
9530053A07Rik T A 7: 28,144,256 C856* probably null Het
Acss2 G A 2: 155,574,690 probably null Het
Adamts10 G A 17: 33,531,616 R210H probably benign Het
Als2 T C 1: 59,167,616 probably null Het
Aplp2 A T 9: 31,152,356 M652K possibly damaging Het
Atrn A G 2: 130,961,571 I560M possibly damaging Het
Bicc1 T C 10: 70,946,604 D602G possibly damaging Het
Cdh4 A G 2: 179,444,810 probably null Het
Clasp1 T A 1: 118,542,997 probably null Het
Col6a6 A G 9: 105,767,324 I1255T probably damaging Het
Comp G T 8: 70,381,350 V672L probably damaging Het
Dbnl T G 11: 5,795,486 D122E probably damaging Het
Dgkz G A 2: 91,942,675 R346C probably damaging Het
Dnhd1 C T 7: 105,678,309 R54C probably damaging Het
Elmo3 T C 8: 105,306,714 I121T probably damaging Het
Fam184b A G 5: 45,542,232 L614P probably damaging Het
Fbxo18 T C 2: 11,749,537 R797G probably benign Het
Gata6 A G 18: 11,059,108 T392A probably damaging Het
Gm17783 T A 16: 45,528,492 T106S possibly damaging Het
Gm21731 A T 13: 120,240,979 M104L probably benign Het
Gm29609 A G 5: 31,154,232 F855S probably benign Het
Gm3424 T C 14: 5,829,330 N88D possibly damaging Het
Gnas T A 2: 174,298,099 S80T unknown Het
Hsd17b14 C A 7: 45,566,146 P190Q probably damaging Het
Iqch C T 9: 63,445,521 V955I possibly damaging Het
Kcnt2 T C 1: 140,376,384 V164A probably benign Het
Krt87 A G 15: 101,438,634 L46P probably damaging Het
Lef1 A G 3: 131,191,099 M237V probably benign Het
Lmbr1l A T 15: 98,909,386 probably null Het
Lrrc49 T C 9: 60,610,403 I408V probably damaging Het
Luc7l3 T C 11: 94,295,965 S365G unknown Het
March2 A T 17: 33,703,058 C109* probably null Het
Metrnl T A 11: 121,715,970 C284S probably damaging Het
Mmachc G A 4: 116,705,885 T91I probably benign Het
Mrps7 T G 11: 115,606,870 M187R probably damaging Het
Ncapd3 A G 9: 27,067,040 E845G probably damaging Het
Olfr1393 T A 11: 49,280,333 F62I probably damaging Het
Olfr272 A T 4: 52,911,376 D139E probably benign Het
Ooep T A 9: 78,378,065 T90S possibly damaging Het
Pcdhb18 A T 18: 37,491,609 D664V probably damaging Het
Pigz T C 16: 31,945,131 S336P probably benign Het
Pou2f2 A T 7: 25,116,128 D71E probably benign Het
Reep6 G T 10: 80,335,199 R303L possibly damaging Het
Rmdn2 A T 17: 79,627,868 S137C Het
Rnf220 A T 4: 117,489,930 L95H probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,911 probably benign Het
Stxbp1 A T 2: 32,818,505 S83T probably damaging Het
Trappc11 T C 8: 47,505,582 probably null Het
Ttn G T 2: 76,791,301 D15598E probably damaging Het
Vav2 T A 2: 27,275,002 R645W probably damaging Het
Vmn1r169 T A 7: 23,577,987 V268D probably benign Het
Zp2 A T 7: 120,136,056 C365S probably damaging Het
Other mutations in 1700020D05Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02983:1700020D05Rik APN 19 5503181 missense possibly damaging 0.46
IGL03285:1700020D05Rik APN 19 5503177 missense probably damaging 1.00
R4445:1700020D05Rik UTSW 19 5502994 missense probably damaging 1.00
R4804:1700020D05Rik UTSW 19 5503000 missense possibly damaging 0.82
R5449:1700020D05Rik UTSW 19 5503264 missense probably benign 0.44
R5542:1700020D05Rik UTSW 19 5503435 missense probably damaging 0.99
R6435:1700020D05Rik UTSW 19 5503418 missense probably benign 0.06
R6476:1700020D05Rik UTSW 19 5503225 missense probably damaging 1.00
R6764:1700020D05Rik UTSW 19 5502872 missense probably damaging 1.00
R7102:1700020D05Rik UTSW 19 5503595 missense probably benign 0.00
R7232:1700020D05Rik UTSW 19 5503631 missense possibly damaging 0.87
R7640:1700020D05Rik UTSW 19 5503007 missense probably damaging 1.00
R9459:1700020D05Rik UTSW 19 5503729 missense probably benign
Predicted Primers PCR Primer
(F):5'- CACCAGACATCGTTTTCTGGGATG -3'
(R):5'- AAGCTTTCGTCAGGTCCAGG -3'

Sequencing Primer
(F):5'- GTGGCCATTCATTAAGATGAGCCC -3'
(R):5'- TCAGGTCCAGGCCACCTC -3'
Posted On 2019-10-17