Incidental Mutation 'R7542:Trpc4'
ID 583928
Institutional Source Beutler Lab
Gene Symbol Trpc4
Ensembl Gene ENSMUSG00000027748
Gene Name transient receptor potential cation channel, subfamily C, member 4
Synonyms Trrp4, STRPC4, Trp4, CCE1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.207) question?
Stock # R7542 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 54156035-54318471 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 54315654 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 706 (Y706C)
Ref Sequence ENSEMBL: ENSMUSP00000029311 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029311] [ENSMUST00000200048] [ENSMUST00000200341]
AlphaFold Q9QUQ5
Predicted Effect probably damaging
Transcript: ENSMUST00000029311
AA Change: Y706C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029311
Gene: ENSMUSG00000027748
AA Change: Y706C

DomainStartEndE-ValueType
Blast:ANK 33 63 4e-7 BLAST
ANK 69 98 8.72e-1 SMART
ANK 141 170 5.09e-2 SMART
Pfam:TRP_2 176 238 1.2e-30 PFAM
transmembrane domain 328 350 N/A INTRINSIC
Pfam:Ion_trans 363 632 4.2e-33 PFAM
low complexity region 763 780 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000200048
AA Change: Y706C

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143593
Gene: ENSMUSG00000027748
AA Change: Y706C

DomainStartEndE-ValueType
Blast:ANK 33 63 2e-7 BLAST
ANK 69 98 8.72e-1 SMART
ANK 141 170 5.09e-2 SMART
Pfam:TRP_2 176 238 1.1e-30 PFAM
transmembrane domain 328 350 N/A INTRINSIC
Pfam:Ion_trans 363 632 3.5e-33 PFAM
low complexity region 763 782 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200341
SMART Domains Protein: ENSMUSP00000142921
Gene: ENSMUSG00000027748

DomainStartEndE-ValueType
Blast:ANK 33 63 2e-7 BLAST
ANK 69 98 8.72e-1 SMART
ANK 141 170 5.09e-2 SMART
Pfam:TRP_2 176 238 6.4e-33 PFAM
transmembrane domain 331 351 N/A INTRINSIC
transmembrane domain 366 383 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the canonical subfamily of transient receptor potential cation channels. The encoded protein forms a non-selective calcium-permeable cation channel that is activated by Gq-coupled receptors and tyrosine kinases, and plays a role in multiple processes including endothelial permeability, vasodilation, neurotransmitter release and cell proliferation. Single nucleotide polymorphisms in this gene may be associated with generalized epilepsy with photosensitivity. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mice exhibit a significant reduction in agonist-induced Ca2+ entry and vasorelaxation of aortic rings. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik A T 3: 108,458,227 probably benign Het
Adam24 A T 8: 40,680,809 T439S possibly damaging Het
AF529169 T A 9: 89,601,911 T478S probably damaging Het
Akap11 A T 14: 78,510,292 S1552T Het
Akap6 A G 12: 53,069,234 E1040G probably damaging Het
Alms1 A T 6: 85,629,362 T2196S possibly damaging Het
Alox12e T C 11: 70,321,756 Q89R possibly damaging Het
AW551984 T A 9: 39,594,631 E423D possibly damaging Het
Ccpg1 T A 9: 73,012,459 V452D probably damaging Het
Cdk5r1 T C 11: 80,478,364 F286L probably damaging Het
Cgref1 A T 5: 30,933,593 N292K probably damaging Het
Clgn A T 8: 83,395,545 S32C possibly damaging Het
Csk C A 9: 57,629,000 probably null Het
Dchs2 A G 3: 83,269,284 T850A probably benign Het
Defb2 T C 8: 21,843,344 V45A probably benign Het
Disp2 A G 2: 118,791,118 Q777R probably damaging Het
Dll1 C T 17: 15,370,347 C369Y probably damaging Het
Dnah7c A G 1: 46,784,498 I3766V probably benign Het
Fam53a A G 5: 33,607,471 M297T probably damaging Het
Fat4 A G 3: 38,981,355 D3052G possibly damaging Het
Fat4 A T 3: 38,981,621 I3141F possibly damaging Het
Fbxw10 T C 11: 62,850,596 V180A probably benign Het
Frem2 A T 3: 53,652,579 D1502E probably damaging Het
Fsip2 A T 2: 82,984,852 N3643I possibly damaging Het
Furin A G 7: 80,393,459 S335P probably damaging Het
Glb1l3 C A 9: 26,818,195 A659S possibly damaging Het
Gm16486 A G 8: 70,708,766 T203A possibly damaging Het
Gm8011 A T 14: 42,466,784 R175* probably null Het
Gna15 A G 10: 81,514,302 S89P probably damaging Het
Grm2 A T 9: 106,651,169 L172Q probably damaging Het
Kcnc3 A G 7: 44,595,714 D476G possibly damaging Het
Kcnh6 A G 11: 106,014,561 T216A possibly damaging Het
Kdm2a G A 19: 4,333,830 probably benign Het
Lrrc9 T C 12: 72,506,320 I1332T probably damaging Het
Maea T C 5: 33,371,663 C317R probably damaging Het
Manba T C 3: 135,566,593 V707A probably benign Het
Mcph1 C T 8: 18,631,689 R281C probably benign Het
Med25 A T 7: 44,891,791 D99E probably damaging Het
Megf10 C A 18: 57,189,570 D62E probably benign Het
Myod1 A T 7: 46,376,673 M1L probably benign Het
Nav3 A T 10: 109,823,533 M741K possibly damaging Het
Odf2l A C 3: 145,153,436 K618T probably damaging Het
Olfr1212 A T 2: 88,958,775 E103V probably benign Het
Pcdha2 G A 18: 36,940,089 G258R probably damaging Het
Pcdha3 G A 18: 36,947,731 A509T possibly damaging Het
Pde4dip A G 3: 97,766,655 V315A possibly damaging Het
Prim1 T C 10: 128,018,034 V107A probably damaging Het
Pxdc1 A G 13: 34,638,163 probably null Het
Rab7b C T 1: 131,711,641 H182Y probably benign Het
Reln C A 5: 21,955,181 G2130V probably damaging Het
Retreg1 T A 15: 25,941,210 M1K probably null Het
Rras G A 7: 45,020,342 R94Q probably damaging Het
Rundc3a T A 11: 102,400,045 L318Q probably benign Het
Scgb2b18 A T 7: 33,173,322 probably null Het
Setd1b A T 5: 123,148,447 M519L unknown Het
Tep1 G A 14: 50,862,491 Q426* probably null Het
Tesk1 G T 4: 43,445,941 M291I probably benign Het
Tgs1 A G 4: 3,595,439 D536G probably benign Het
Thbs1 C T 2: 118,121,174 T825M probably damaging Het
Tmem59l T C 8: 70,485,164 N189D possibly damaging Het
Trim30c A T 7: 104,382,218 D463E possibly damaging Het
Ttc13 A T 8: 124,675,103 probably null Het
Tulp1 T C 17: 28,363,755 K140E probably benign Het
Urb2 A G 8: 124,028,588 I345V probably benign Het
Vmn2r43 T C 7: 8,255,489 M242V probably benign Het
Zcwpw1 T C 5: 137,819,523 V509A probably benign Het
Zfp202 T C 9: 40,211,147 C402R probably benign Het
Other mutations in Trpc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Trpc4 APN 3 54302175 missense probably damaging 1.00
IGL01067:Trpc4 APN 3 54222562 missense probably benign 0.01
IGL01475:Trpc4 APN 3 54266407 missense possibly damaging 0.87
IGL01544:Trpc4 APN 3 54302146 missense probably damaging 0.99
IGL01688:Trpc4 APN 3 54266074 splice site probably benign
IGL02134:Trpc4 APN 3 54315654 missense possibly damaging 0.46
IGL02237:Trpc4 APN 3 54222362 missense probably damaging 1.00
IGL02301:Trpc4 APN 3 54291232 missense probably damaging 0.97
IGL02549:Trpc4 APN 3 54222349 missense possibly damaging 0.92
IGL02742:Trpc4 APN 3 54299246 missense probably damaging 1.00
IGL02815:Trpc4 APN 3 54299274 splice site probably benign
R0498:Trpc4 UTSW 3 54291211 missense probably damaging 1.00
R0555:Trpc4 UTSW 3 54302090 splice site probably benign
R0609:Trpc4 UTSW 3 54194768 missense probably damaging 1.00
R1351:Trpc4 UTSW 3 54195002 missense probably damaging 1.00
R1595:Trpc4 UTSW 3 54315815 missense probably benign 0.02
R1623:Trpc4 UTSW 3 54299179 missense probably damaging 1.00
R1763:Trpc4 UTSW 3 54194822 missense possibly damaging 0.90
R1843:Trpc4 UTSW 3 54279994 missense probably benign 0.19
R1856:Trpc4 UTSW 3 54279989 missense probably damaging 1.00
R1936:Trpc4 UTSW 3 54279890 missense probably damaging 1.00
R2196:Trpc4 UTSW 3 54302193 missense probably benign 0.03
R2441:Trpc4 UTSW 3 54222283 missense probably damaging 0.96
R2877:Trpc4 UTSW 3 54291340 missense probably damaging 1.00
R3846:Trpc4 UTSW 3 54318012 missense probably benign 0.22
R3931:Trpc4 UTSW 3 54318095 missense probably damaging 1.00
R4854:Trpc4 UTSW 3 54302218 missense probably damaging 1.00
R5024:Trpc4 UTSW 3 54194796 missense probably benign 0.11
R5284:Trpc4 UTSW 3 54279947 missense probably damaging 0.99
R5320:Trpc4 UTSW 3 54299178 missense probably damaging 0.99
R5973:Trpc4 UTSW 3 54315842 missense probably damaging 1.00
R6276:Trpc4 UTSW 3 54318020 missense probably benign 0.25
R6335:Trpc4 UTSW 3 54317574 critical splice donor site probably null
R7082:Trpc4 UTSW 3 54299098 nonsense probably null
R7215:Trpc4 UTSW 3 54194896 missense possibly damaging 0.83
R7299:Trpc4 UTSW 3 54317627 missense possibly damaging 0.87
R7423:Trpc4 UTSW 3 54318029 missense probably benign
R7459:Trpc4 UTSW 3 54291232 missense probably damaging 0.97
R7538:Trpc4 UTSW 3 54318095 missense possibly damaging 0.92
R7823:Trpc4 UTSW 3 54302219 nonsense probably null
R7868:Trpc4 UTSW 3 54302286 missense probably benign 0.00
R8046:Trpc4 UTSW 3 54194914 missense probably damaging 1.00
R8164:Trpc4 UTSW 3 54315805 missense probably benign 0.31
R8235:Trpc4 UTSW 3 54302248 missense probably benign 0.01
R8263:Trpc4 UTSW 3 54222335 missense probably damaging 0.99
R8438:Trpc4 UTSW 3 54222253 missense possibly damaging 0.90
R8854:Trpc4 UTSW 3 54194701 nonsense probably null
R8987:Trpc4 UTSW 3 54194711 missense probably benign 0.09
R9023:Trpc4 UTSW 3 54194833 missense possibly damaging 0.52
R9196:Trpc4 UTSW 3 54222451 missense probably damaging 1.00
R9210:Trpc4 UTSW 3 54266320 missense probably benign 0.07
R9350:Trpc4 UTSW 3 54302189 missense probably damaging 1.00
X0066:Trpc4 UTSW 3 54194750 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGTGACTATGGCTCATTGC -3'
(R):5'- TTAAAGGCTGCCTCCACACG -3'

Sequencing Primer
(F):5'- TGCCCCCACTTTGGTGATAAAAG -3'
(R):5'- ACGCTGTCTCCGCGATGAAG -3'
Posted On 2019-10-17