Incidental Mutation 'R7542:Megf10'
ID 583983
Institutional Source Beutler Lab
Gene Symbol Megf10
Ensembl Gene ENSMUSG00000024593
Gene Name multiple EGF-like-domains 10
Synonyms 3000002B06Rik, LOC240312
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.165) question?
Stock # R7542 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 57133090-57297467 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 57189570 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 62 (D62E)
Ref Sequence ENSEMBL: ENSMUSP00000075174 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075770] [ENSMUST00000139892]
AlphaFold Q6DIB5
Predicted Effect probably benign
Transcript: ENSMUST00000075770
AA Change: D62E

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000075174
Gene: ENSMUSG00000024593
AA Change: D62E

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
EGF 108 136 9.41e-2 SMART
EGF_Lam 152 191 3.57e-2 SMART
EGF 190 222 5.79e-2 SMART
EGF 233 265 1.78e-2 SMART
EGF_Lam 281 320 7.58e-6 SMART
EGF 319 351 7.13e-2 SMART
EGF_Lam 368 409 9.05e-4 SMART
EGF 408 440 8.78e-2 SMART
EGF 451 483 2.85e-1 SMART
EGF 494 526 2.02e-1 SMART
EGF_Lam 542 581 1.04e-3 SMART
EGF 580 612 1.91e-2 SMART
EGF 623 657 2.16e1 SMART
EGF 668 700 2.48e-1 SMART
EGF 711 743 2.81e0 SMART
EGF_Lam 759 798 4.16e-3 SMART
EGF 797 829 1.73e0 SMART
transmembrane domain 856 878 N/A INTRINSIC
low complexity region 1014 1026 N/A INTRINSIC
low complexity region 1131 1146 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139892
AA Change: D62E

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000116814
Gene: ENSMUSG00000024593
AA Change: D62E

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
EGF 108 136 9.41e-2 SMART
EGF_Lam 152 191 3.57e-2 SMART
EGF 190 222 5.79e-2 SMART
EGF 233 265 1.78e-2 SMART
EGF_Lam 281 320 7.58e-6 SMART
EGF 319 351 7.13e-2 SMART
EGF_Lam 368 409 9.05e-4 SMART
EGF 408 440 8.78e-2 SMART
EGF 451 483 2.85e-1 SMART
EGF 494 526 2.02e-1 SMART
EGF_Lam 542 581 1.04e-3 SMART
EGF 580 612 1.91e-2 SMART
EGF 623 657 2.16e1 SMART
EGF 668 700 2.48e-1 SMART
EGF 711 743 2.81e0 SMART
EGF_Lam 759 798 4.16e-3 SMART
EGF 797 829 1.73e0 SMART
transmembrane domain 856 878 N/A INTRINSIC
low complexity region 1014 1026 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the multiple epidermal growth factor-like domains protein family. The encoded protein plays a role in cell adhesion, motility and proliferation, and is a critical mediator of apoptotic cell phagocytosis as well as amyloid-beta peptide uptake in the brain. Expression of this gene may be associated with schizophrenia, and mutations in this gene are a cause of early-onset myopathy, areflexia, respiratory distress, and dysphagia (EMARDD) as well as congenital myopathy with minicores. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a targeted allele exhibit abnormal spacing of starburst amacrine cells and horizontal cells. Homozygotes for another targeted allele exhibit impaired phagocytosis of apoptotic cells by astrocytes. Mice heterozygous for this same allele exhibit mild disorganization of starburts amacrine cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik A T 3: 108,458,227 probably benign Het
Adam24 A T 8: 40,680,809 T439S possibly damaging Het
AF529169 T A 9: 89,601,911 T478S probably damaging Het
Akap11 A T 14: 78,510,292 S1552T Het
Akap6 A G 12: 53,069,234 E1040G probably damaging Het
Alms1 A T 6: 85,629,362 T2196S possibly damaging Het
Alox12e T C 11: 70,321,756 Q89R possibly damaging Het
AW551984 T A 9: 39,594,631 E423D possibly damaging Het
Ccpg1 T A 9: 73,012,459 V452D probably damaging Het
Cdk5r1 T C 11: 80,478,364 F286L probably damaging Het
Cgref1 A T 5: 30,933,593 N292K probably damaging Het
Clgn A T 8: 83,395,545 S32C possibly damaging Het
Csk C A 9: 57,629,000 probably null Het
Dchs2 A G 3: 83,269,284 T850A probably benign Het
Defb2 T C 8: 21,843,344 V45A probably benign Het
Disp2 A G 2: 118,791,118 Q777R probably damaging Het
Dll1 C T 17: 15,370,347 C369Y probably damaging Het
Dnah7c A G 1: 46,784,498 I3766V probably benign Het
Fam53a A G 5: 33,607,471 M297T probably damaging Het
Fat4 A G 3: 38,981,355 D3052G possibly damaging Het
Fat4 A T 3: 38,981,621 I3141F possibly damaging Het
Fbxw10 T C 11: 62,850,596 V180A probably benign Het
Frem2 A T 3: 53,652,579 D1502E probably damaging Het
Fsip2 A T 2: 82,984,852 N3643I possibly damaging Het
Furin A G 7: 80,393,459 S335P probably damaging Het
Glb1l3 C A 9: 26,818,195 A659S possibly damaging Het
Gm16486 A G 8: 70,708,766 T203A possibly damaging Het
Gm8011 A T 14: 42,466,784 R175* probably null Het
Gna15 A G 10: 81,514,302 S89P probably damaging Het
Grm2 A T 9: 106,651,169 L172Q probably damaging Het
Kcnc3 A G 7: 44,595,714 D476G possibly damaging Het
Kcnh6 A G 11: 106,014,561 T216A possibly damaging Het
Kdm2a G A 19: 4,333,830 probably benign Het
Lrrc9 T C 12: 72,506,320 I1332T probably damaging Het
Maea T C 5: 33,371,663 C317R probably damaging Het
Manba T C 3: 135,566,593 V707A probably benign Het
Mcph1 C T 8: 18,631,689 R281C probably benign Het
Med25 A T 7: 44,891,791 D99E probably damaging Het
Myod1 A T 7: 46,376,673 M1L probably benign Het
Nav3 A T 10: 109,823,533 M741K possibly damaging Het
Odf2l A C 3: 145,153,436 K618T probably damaging Het
Olfr1212 A T 2: 88,958,775 E103V probably benign Het
Pcdha2 G A 18: 36,940,089 G258R probably damaging Het
Pcdha3 G A 18: 36,947,731 A509T possibly damaging Het
Pde4dip A G 3: 97,766,655 V315A possibly damaging Het
Prim1 T C 10: 128,018,034 V107A probably damaging Het
Pxdc1 A G 13: 34,638,163 probably null Het
Rab7b C T 1: 131,711,641 H182Y probably benign Het
Reln C A 5: 21,955,181 G2130V probably damaging Het
Retreg1 T A 15: 25,941,210 M1K probably null Het
Rras G A 7: 45,020,342 R94Q probably damaging Het
Rundc3a T A 11: 102,400,045 L318Q probably benign Het
Scgb2b18 A T 7: 33,173,322 probably null Het
Setd1b A T 5: 123,148,447 M519L unknown Het
Tep1 G A 14: 50,862,491 Q426* probably null Het
Tesk1 G T 4: 43,445,941 M291I probably benign Het
Tgs1 A G 4: 3,595,439 D536G probably benign Het
Thbs1 C T 2: 118,121,174 T825M probably damaging Het
Tmem59l T C 8: 70,485,164 N189D possibly damaging Het
Trim30c A T 7: 104,382,218 D463E possibly damaging Het
Trpc4 A G 3: 54,315,654 Y706C probably damaging Het
Ttc13 A T 8: 124,675,103 probably null Het
Tulp1 T C 17: 28,363,755 K140E probably benign Het
Urb2 A G 8: 124,028,588 I345V probably benign Het
Vmn2r43 T C 7: 8,255,489 M242V probably benign Het
Zcwpw1 T C 5: 137,819,523 V509A probably benign Het
Zfp202 T C 9: 40,211,147 C402R probably benign Het
Other mutations in Megf10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Megf10 APN 18 57240628 missense probably damaging 1.00
IGL00736:Megf10 APN 18 57292710 missense probably benign 0.35
IGL01631:Megf10 APN 18 57259797 missense possibly damaging 0.61
IGL02488:Megf10 APN 18 57292632 missense probably damaging 1.00
IGL02747:Megf10 APN 18 57290493 missense probably benign 0.43
IGL03298:Megf10 APN 18 57283838 nonsense probably null
deep UTSW 18 57262131 missense probably damaging 1.00
megalodon UTSW 18 57287976 nonsense probably null
sharkie UTSW 18 57191185 nonsense probably null
IGL03046:Megf10 UTSW 18 57287983 missense possibly damaging 0.95
PIT4696001:Megf10 UTSW 18 57277688 missense probably damaging 1.00
R0020:Megf10 UTSW 18 57287893 missense possibly damaging 0.81
R0020:Megf10 UTSW 18 57287893 missense possibly damaging 0.81
R0115:Megf10 UTSW 18 57259802 missense possibly damaging 0.67
R0455:Megf10 UTSW 18 57252982 missense probably benign 0.34
R0602:Megf10 UTSW 18 57262100 missense probably damaging 0.98
R0630:Megf10 UTSW 18 57287995 missense probably benign 0.14
R0652:Megf10 UTSW 18 57277724 missense probably benign 0.00
R0658:Megf10 UTSW 18 57252896 missense probably benign 0.00
R0761:Megf10 UTSW 18 57287976 nonsense probably null
R1013:Megf10 UTSW 18 57261219 missense probably benign 0.00
R1130:Megf10 UTSW 18 57262006 missense probably benign 0.06
R1451:Megf10 UTSW 18 57252859 missense probably damaging 0.97
R1699:Megf10 UTSW 18 57277730 splice site probably null
R1729:Megf10 UTSW 18 57240792 critical splice donor site probably null
R1784:Megf10 UTSW 18 57240792 critical splice donor site probably null
R1870:Megf10 UTSW 18 57191185 nonsense probably null
R1961:Megf10 UTSW 18 57212354 missense probably damaging 0.97
R2094:Megf10 UTSW 18 57281713 nonsense probably null
R2213:Megf10 UTSW 18 57288009 nonsense probably null
R2853:Megf10 UTSW 18 57293931 missense probably damaging 1.00
R3772:Megf10 UTSW 18 57283862 missense probably benign 0.39
R3774:Megf10 UTSW 18 57277105 missense probably damaging 1.00
R3775:Megf10 UTSW 18 57277105 missense probably damaging 1.00
R3776:Megf10 UTSW 18 57277105 missense probably damaging 1.00
R3858:Megf10 UTSW 18 57275835 splice site probably benign
R3911:Megf10 UTSW 18 57289393 missense probably damaging 0.99
R3966:Megf10 UTSW 18 57180574 missense probably damaging 1.00
R4043:Megf10 UTSW 18 57259798 missense probably damaging 0.98
R4131:Megf10 UTSW 18 57180535 missense probably damaging 1.00
R4598:Megf10 UTSW 18 57189603 critical splice donor site probably null
R4598:Megf10 UTSW 18 57287812 missense probably damaging 1.00
R4726:Megf10 UTSW 18 57287792 missense probably benign 0.32
R4765:Megf10 UTSW 18 57287794 missense possibly damaging 0.56
R4874:Megf10 UTSW 18 57293858 missense probably benign 0.00
R4928:Megf10 UTSW 18 57240673 missense probably benign
R5412:Megf10 UTSW 18 57191147 missense probably damaging 0.99
R5901:Megf10 UTSW 18 57277108 missense probably benign 0.11
R6015:Megf10 UTSW 18 57253028 missense probably benign 0.01
R6036:Megf10 UTSW 18 57242727 missense probably damaging 1.00
R6036:Megf10 UTSW 18 57242727 missense probably damaging 1.00
R6041:Megf10 UTSW 18 57180549 missense probably benign
R6369:Megf10 UTSW 18 57261187 missense probably benign 0.06
R6479:Megf10 UTSW 18 57246570 missense possibly damaging 0.76
R6489:Megf10 UTSW 18 57291807 missense probably benign 0.01
R7228:Megf10 UTSW 18 57189589 missense probably damaging 1.00
R7296:Megf10 UTSW 18 57275753 missense probably damaging 1.00
R7437:Megf10 UTSW 18 57262131 missense probably damaging 1.00
R7461:Megf10 UTSW 18 57252853 missense probably damaging 0.98
R7488:Megf10 UTSW 18 57191115 missense probably damaging 0.99
R7492:Megf10 UTSW 18 57291794 missense probably benign 0.00
R7636:Megf10 UTSW 18 57276989 missense possibly damaging 0.85
R7646:Megf10 UTSW 18 57293999 unclassified probably benign
R7650:Megf10 UTSW 18 57293999 unclassified probably benign
R7713:Megf10 UTSW 18 57293999 unclassified probably benign
R7714:Megf10 UTSW 18 57293999 unclassified probably benign
R7716:Megf10 UTSW 18 57293999 unclassified probably benign
R7796:Megf10 UTSW 18 57277659 missense possibly damaging 0.85
R7915:Megf10 UTSW 18 57240735 missense probably benign 0.05
R8221:Megf10 UTSW 18 57283821 missense probably benign 0.00
R8527:Megf10 UTSW 18 57292718 missense probably benign 0.00
R8559:Megf10 UTSW 18 57240627 missense probably damaging 1.00
R9117:Megf10 UTSW 18 57259701 missense probably damaging 1.00
R9337:Megf10 UTSW 18 57261180 nonsense probably null
R9481:Megf10 UTSW 18 57262018 missense probably benign 0.38
R9644:Megf10 UTSW 18 57242701 missense probably benign
RF003:Megf10 UTSW 18 57294027 unclassified probably benign
Z1176:Megf10 UTSW 18 57277694 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGGCATGATTTCAATCCCTAGG -3'
(R):5'- CTTGGGATCAAAGCCCTCAAC -3'

Sequencing Primer
(F):5'- AAATCTGTGTGAGGTTGCAAATG -3'
(R):5'- ACAACTGCTCACTGGGTACATGG -3'
Posted On 2019-10-17