Mutagenetix > Incidental Mutation

Incidental Mutation 'R0617:Sis'

58400

Institutional Source

Beutler Lab

Gene Symbol

Sis

Ensembl Gene

ENSMUSG00000027790

Gene Name

sucrase isomaltase (alpha-glucosidase)

Synonyms

Si-s, sucrase-isomaltase

MMRRC Submission

038806-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0617 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

72888557-72967863 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 72965605 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Arginine at position 67 (C67R)

Ref Sequence

ENSEMBL: ENSMUSP00000129116 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094190] [ENSMUST00000167334]

AlphaFold

F8VQM5

Predicted Effect

probably damaging
Transcript: ENSMUST00000094190
AA Change: C67R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000091742
Gene: ENSMUSG00000027790
AA Change: C67R

Domain	Start	End	E-Value	Type
transmembrane domain	13	32	N/A	INTRINSIC
PD	51	103	1.92e-12	SMART
Pfam:NtCtMGAM_N	115	224	1.2e-35	PFAM
Pfam:Gal_mutarotas_2	225	294	4.8e-9	PFAM
Pfam:Glyco_hydro_31	314	787	2.1e-142	PFAM
PD	917	972	6.69e-12	SMART
Pfam:NtCtMGAM_N	985	1098	6e-33	PFAM
Blast:ANK	1138	1168	1e-5	BLAST
Pfam:Glyco_hydro_31	1186	1682	8.4e-137	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000167334
AA Change: C67R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000129116
Gene: ENSMUSG00000027790
AA Change: C67R

Domain	Start	End	E-Value	Type
transmembrane domain	13	32	N/A	INTRINSIC
PD	51	103	1.92e-12	SMART
Pfam:NtCtMGAM_N	115	224	1.2e-35	PFAM
Pfam:Gal_mutarotas_2	225	294	4.8e-9	PFAM
Pfam:Glyco_hydro_31	314	787	2.1e-142	PFAM
PD	917	972	6.69e-12	SMART
Pfam:NtCtMGAM_N	985	1098	6e-33	PFAM
Blast:ANK	1138	1168	1e-5	BLAST
Pfam:Glyco_hydro_31	1186	1682	8.4e-137	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000170445

Meta Mutation Damage Score

0.9131

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.6%
20x: 95.5%

Validation Efficiency

98% (130/133)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sucrase-isomaltase enzyme that is expressed in the intestinal brush border. The encoded protein is synthesized as a precursor protein that is cleaved by pancreatic proteases into two enzymatic subunits sucrase and isomaltase. These two subunits heterodimerize to form the sucrose-isomaltase complex. This complex is essential for the digestion of dietary carbohydrates including starch, sucrose and isomaltose. Mutations in this gene are the cause of congenital sucrase-isomaltase deficiency.[provided by RefSeq, Apr 2010]

Allele List at MGI

Other mutations in this stock

Total: 130 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017D01Rik	C	A	19: 11,112,400	L40F	probably damaging	Het
4930555F03Rik	A	T	8: 49,500,492		noncoding transcript	Het
A630073D07Rik	T	C	6: 132,626,737		probably benign	Het
Abca16	G	A	7: 120,433,611		probably benign	Het
Abca5	A	T	11: 110,279,689	D1265E	probably damaging	Het
Abcf1	C	T	17: 35,961,187	V312I	probably benign	Het
Abhd12	T	A	2: 150,846,365		probably null	Het
Adam23	A	G	1: 63,543,147	H318R	probably benign	Het
Adcy2	T	A	13: 68,678,606	K660*	probably null	Het
Adgrf3	T	C	5: 30,195,080	T972A	probably benign	Het
Adipoq	T	A	16: 23,155,410	D62E	probably damaging	Het
Akap2	T	C	4: 57,829,434		probably benign	Het
Alk	G	T	17: 72,603,583	P43T	probably damaging	Het
Arap2	AT	ATT	5: 62,649,907		probably benign	Het
Arhgef28	G	T	13: 97,970,355	T687K	probably benign	Het
Arrb1	T	C	7: 99,594,677	L278P	probably damaging	Het
Atad2b	C	A	12: 4,937,401	D76E	probably benign	Het
Atm	A	T	9: 53,458,941	Y2290*	probably null	Het
Atrn	T	A	2: 130,995,085		probably null	Het
Bpifb1	A	G	2: 154,212,947	D253G	possibly damaging	Het
Bpifb9b	C	T	2: 154,319,625	T559M	probably benign	Het
Bsn	T	C	9: 108,107,240	E3205G	unknown	Het
Cacna1c	T	C	6: 118,602,213	Y1599C	probably damaging	Het
Ccdc40	A	G	11: 119,242,804	D590G	probably damaging	Het
Ccdc68	A	G	18: 69,946,552		probably null	Het
Ccdc97	G	A	7: 25,714,420	R279C	probably damaging	Het
Ccm2l	A	G	2: 153,070,900	T120A	probably damaging	Het
Cfap54	T	C	10: 92,829,650		probably benign	Het
Cfh	A	G	1: 140,100,883	S1043P	probably benign	Het
Chil3	T	C	3: 106,155,756	K173E	probably benign	Het
Cib2	T	C	9: 54,554,496	D26G	possibly damaging	Het
Col24a1	T	C	3: 145,314,120	V84A	probably damaging	Het
Csn3	T	C	5: 87,929,871	Y79H	probably benign	Het
Ddx47	T	A	6: 135,017,122	V149E	probably damaging	Het
Dennd5b	A	T	6: 149,033,262		probably benign	Het
Desi1	T	C	15: 81,998,198	N109D	probably damaging	Het
Fam13c	T	C	10: 70,536,352		probably benign	Het
Fam234a	A	T	17: 26,216,617	D264E	probably benign	Het
Fanca	A	G	8: 123,288,070	F831S	probably damaging	Het
Fancm	C	T	12: 65,097,317	R518*	probably null	Het
Fat2	A	G	11: 55,311,843	V135A	possibly damaging	Het
Fbxl17	A	C	17: 63,384,992	F42V	probably damaging	Het
Fgd3	A	T	13: 49,264,697	V631E	possibly damaging	Het
Fhod3	G	A	18: 25,112,679		probably benign	Het
Focad	T	C	4: 88,121,288		probably benign	Het
Foxn4	C	A	5: 114,261,068		probably benign	Het
Gm1673	T	C	5: 33,983,552		probably benign	Het
Gm2381	A	T	7: 42,819,978	C241S	probably damaging	Het
Gm6483	T	G	8: 19,693,709	F117V	probably damaging	Het
Hectd4	T	C	5: 121,343,232		probably benign	Het
Hecw1	T	A	13: 14,280,442	Q676L	probably benign	Het
Hipk2	G	A	6: 38,747,485	R437C	possibly damaging	Het
Ifnar1	T	C	16: 91,501,682	Y396H	probably damaging	Het
Ints5	A	T	19: 8,896,019	K447N	probably damaging	Het
Iqsec1	T	C	6: 90,689,970	Y495C	probably damaging	Het
Itga5	C	T	15: 103,356,315		probably null	Het
Kcnk4	T	A	19: 6,928,160		probably benign	Het
Kmo	A	G	1: 175,647,190	T174A	possibly damaging	Het
Krt36	T	C	11: 100,102,275	D458G	probably damaging	Het
Krtap16-1	G	T	11: 99,986,495	P28T	probably damaging	Het
Lama3	T	C	18: 12,419,258		probably null	Het
Lrrc9	T	C	12: 72,483,014	S920P	probably damaging	Het
Lrrk2	A	T	15: 91,752,278	Y1485F	probably benign	Het
Mical1	C	T	10: 41,481,315	A372V	probably damaging	Het
Mtr	C	T	13: 12,221,432	R636Q	probably benign	Het
Muc4	A	T	16: 32,752,107	T662S	possibly damaging	Het
Myo10	G	A	15: 25,738,005	V546M	probably damaging	Het
Nbeal1	G	A	1: 60,281,832	W2034*	probably null	Het
Nhlrc3	T	C	3: 53,458,623	T150A	probably damaging	Het
Nkx2-1	T	C	12: 56,534,855	H69R	possibly damaging	Het
Nlrp4g	A	T	9: 124,349,540		noncoding transcript	Het
Nod2	A	G	8: 88,653,231	N120S	probably benign	Het
Nol8	T	C	13: 49,654,445	F46L	possibly damaging	Het
Ntrk1	T	C	3: 87,783,933	D308G	possibly damaging	Het
Olfr1036	A	G	2: 86,075,141	M134V	probably benign	Het
Olfr1124	A	G	2: 87,434,661	D58G	probably damaging	Het
Olfr1196	A	G	2: 88,700,696	V211A	probably damaging	Het
Olfr1459	T	C	19: 13,146,363	M99V	probably benign	Het
Olfr1477	C	A	19: 13,502,536	N64K	probably damaging	Het
Olfr313	T	C	11: 58,817,149	V47A	probably damaging	Het
Olfr466	A	T	13: 65,152,878	Y218F	possibly damaging	Het
Olfr640	A	T	7: 104,021,989	S110T	probably damaging	Het
Oog3	A	T	4: 144,160,214	V112D	probably benign	Het
Pcdhb8	C	T	18: 37,357,047	R593C	probably benign	Het
Pgm3	A	G	9: 86,556,190		probably null	Het
Pirt	T	A	11: 66,926,172	V103E	probably damaging	Het
Plxnc1	T	A	10: 94,799,368	D1332V	probably damaging	Het
Ppfia4	A	T	1: 134,328,780	V122E	probably damaging	Het
Pramef17	A	G	4: 143,993,518		probably benign	Het
Prmt2	C	T	10: 76,208,683		probably benign	Het
Prrc2a	G	T	17: 35,153,560	P1702T	probably damaging	Het
Prss39	A	T	1: 34,500,198	H173L	probably damaging	Het
Rabl6	A	G	2: 25,586,866		probably null	Het
Rb1cc1	T	A	1: 6,248,790	I794K	possibly damaging	Het
Reln	T	C	5: 21,920,537	D2716G	probably damaging	Het
Sbf2	ACC	AC	7: 110,330,683		probably null	Het
Sema6d	T	A	2: 124,660,745	F583L	possibly damaging	Het
Setx	T	A	2: 29,146,807	H1101Q	possibly damaging	Het
Skint1	T	A	4: 112,029,399		probably benign	Het
Smg6	C	A	11: 75,162,931	T1413K	probably benign	Het
Spata31d1a	A	T	13: 59,702,259	I685N	possibly damaging	Het
Spef2	T	A	15: 9,592,758	N1499I	probably damaging	Het
Stk11ip	T	A	1: 75,532,288		probably null	Het
Stxbp1	A	C	2: 32,802,783	I407S	probably damaging	Het
Svil	T	C	18: 5,117,002	S2059P	probably damaging	Het
Syne1	C	T	10: 5,350,933	V932M	probably damaging	Het
Tacc1	A	C	8: 25,178,004		probably benign	Het
Tbc1d13	C	A	2: 30,135,564		probably benign	Het
Tbc1d15	A	C	10: 115,239,299	D59E	probably damaging	Het
Tcaf2	A	G	6: 42,642,511	F194S	probably damaging	Het
Terf2ip	T	A	8: 112,011,495	M5K	probably benign	Het
Tgfbr2	A	T	9: 116,158,320	D40E	probably benign	Het
Tm4sf5	T	A	11: 70,510,669	S165T	probably damaging	Het
Tmprss3	A	T	17: 31,193,912	C129S	probably damaging	Het
Tmx2	T	C	2: 84,672,396	D256G	probably benign	Het
Tnr	A	G	1: 159,868,103	D532G	probably damaging	Het
Tnrc18	T	A	5: 142,776,739	H465L	unknown	Het
Togaram2	A	T	17: 71,700,509	Q350L	possibly damaging	Het
Topaz1	G	A	9: 122,749,906	C627Y	possibly damaging	Het
Tpx2	A	T	2: 152,873,138	Q93L	probably benign	Het
Trim54	T	C	5: 31,136,182		probably null	Het
Troap	T	A	15: 99,082,660	C574S	probably damaging	Het
Ubr4	T	C	4: 139,479,062		probably null	Het
Vmn2r51	A	G	7: 10,100,469	V214A	possibly damaging	Het
Vmn2r66	A	T	7: 84,995,276	M642K	probably benign	Het
Vwa5a	T	A	9: 38,723,895	I232N	probably damaging	Het
Zcchc6	A	T	13: 59,816,855		probably null	Het
Zfp820	A	T	17: 21,819,704	S214R	probably damaging	Het
Zfp955b	A	T	17: 33,305,463	S43R	probably damaging	Het
Zgrf1	C	T	3: 127,588,038	T1162M	probably benign	Het

Other mutations in Sis

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00582:Sis	APN	3	72946636	missense	probably benign
IGL00715:Sis	APN	3	72934124	missense	probably damaging	1.00
IGL00721:Sis	APN	3	72943579	missense	probably damaging	1.00
IGL00766:Sis	APN	3	72907237	splice site	probably benign
IGL00783:Sis	APN	3	72946632	missense	probably benign
IGL00805:Sis	APN	3	72934199	missense	probably benign	0.05
IGL00932:Sis	APN	3	72940956	splice site	probably benign
IGL01020:Sis	APN	3	72966838	missense	probably damaging	1.00
IGL01024:Sis	APN	3	72911876	missense	probably damaging	1.00
IGL01286:Sis	APN	3	72941025	missense	probably damaging	1.00
IGL01457:Sis	APN	3	72961021	missense	probably benign
IGL01514:Sis	APN	3	72935920	splice site	probably benign
IGL01986:Sis	APN	3	72945212	missense	probably damaging	1.00
IGL02110:Sis	APN	3	72928699	nonsense	probably null
IGL02132:Sis	APN	3	72947471	missense	probably benign	0.00
IGL02152:Sis	APN	3	72888986	utr 3 prime	probably benign
IGL02200:Sis	APN	3	72943604	missense	probably damaging	0.99
IGL02244:Sis	APN	3	72956190	missense	probably benign	0.19
IGL02307:Sis	APN	3	72911834	splice site	probably benign
IGL02374:Sis	APN	3	72925456	missense	probably benign	0.03
IGL02437:Sis	APN	3	72919614	critical splice acceptor site	probably null
IGL02571:Sis	APN	3	72956304	splice site	probably benign
IGL02601:Sis	APN	3	72913210	missense	probably benign	0.44
IGL03063:Sis	APN	3	72928297	missense	probably benign
IGL03382:Sis	APN	3	72928719	missense	probably benign	0.00
IGL03397:Sis	APN	3	72935879	missense	probably benign	0.44
PIT1430001:Sis	UTSW	3	72922829	missense	probably damaging	0.97
R0013:Sis	UTSW	3	72910476	missense	possibly damaging	0.65
R0013:Sis	UTSW	3	72910476	missense	possibly damaging	0.65
R0046:Sis	UTSW	3	72932094	missense	probably benign	0.01
R0094:Sis	UTSW	3	72921437	missense	probably damaging	1.00
R0096:Sis	UTSW	3	72928267	missense	probably damaging	1.00
R0505:Sis	UTSW	3	72960296	missense	probably benign	0.29
R0544:Sis	UTSW	3	72951642	missense	probably damaging	1.00
R0551:Sis	UTSW	3	72925407	missense	possibly damaging	0.79
R0698:Sis	UTSW	3	72910498	missense	probably damaging	1.00
R0701:Sis	UTSW	3	72941045	missense	probably damaging	1.00
R0704:Sis	UTSW	3	72949822	missense	possibly damaging	0.63
R0706:Sis	UTSW	3	72952531	missense	probably damaging	1.00
R0710:Sis	UTSW	3	72952531	missense	probably damaging	1.00
R0752:Sis	UTSW	3	72952531	missense	probably damaging	1.00
R0753:Sis	UTSW	3	72952531	missense	probably damaging	1.00
R0754:Sis	UTSW	3	72952531	missense	probably damaging	1.00
R0767:Sis	UTSW	3	72952531	missense	probably damaging	1.00
R0769:Sis	UTSW	3	72952531	missense	probably damaging	1.00
R0772:Sis	UTSW	3	72952531	missense	probably damaging	1.00
R0774:Sis	UTSW	3	72952531	missense	probably damaging	1.00
R0776:Sis	UTSW	3	72952531	missense	probably damaging	1.00
R0818:Sis	UTSW	3	72952531	missense	probably damaging	1.00
R0819:Sis	UTSW	3	72952531	missense	probably damaging	1.00
R0885:Sis	UTSW	3	72911949	nonsense	probably null
R1076:Sis	UTSW	3	72934098	missense	probably damaging	0.97
R1140:Sis	UTSW	3	72951616	missense	probably damaging	0.98
R1175:Sis	UTSW	3	72958104	splice site	probably benign
R1301:Sis	UTSW	3	72946582	missense	possibly damaging	0.76
R1437:Sis	UTSW	3	72934142	missense	probably damaging	1.00
R1466:Sis	UTSW	3	72932060	missense	possibly damaging	0.60
R1466:Sis	UTSW	3	72932060	missense	possibly damaging	0.60
R1472:Sis	UTSW	3	72889027	missense	probably benign	0.12
R1584:Sis	UTSW	3	72932060	missense	possibly damaging	0.60
R1707:Sis	UTSW	3	72909087	splice site	probably benign
R1715:Sis	UTSW	3	72889010	missense	possibly damaging	0.47
R1719:Sis	UTSW	3	72965604	missense	probably damaging	1.00
R1728:Sis	UTSW	3	72965645	nonsense	probably null
R1784:Sis	UTSW	3	72965645	nonsense	probably null
R1820:Sis	UTSW	3	72921142	missense	probably damaging	1.00
R1972:Sis	UTSW	3	72921004	missense	probably damaging	1.00
R1973:Sis	UTSW	3	72921004	missense	probably damaging	1.00
R2054:Sis	UTSW	3	72913237	missense	probably benign	0.01
R2233:Sis	UTSW	3	72913194	missense	probably benign	0.03
R2235:Sis	UTSW	3	72913194	missense	probably benign	0.03
R2276:Sis	UTSW	3	72914601	nonsense	probably null
R2435:Sis	UTSW	3	72911904	missense	probably benign	0.01
R2885:Sis	UTSW	3	72909173	missense	probably benign	0.01
R2966:Sis	UTSW	3	72889010	missense	probably benign	0.30
R3708:Sis	UTSW	3	72943523	missense	probably benign	0.02
R3790:Sis	UTSW	3	72921414	missense	probably damaging	1.00
R3807:Sis	UTSW	3	72925596	missense	probably benign	0.01
R3858:Sis	UTSW	3	72928652	missense	probably damaging	0.99
R3974:Sis	UTSW	3	72943635	missense	probably damaging	0.96
R3975:Sis	UTSW	3	72943635	missense	probably damaging	0.96
R4037:Sis	UTSW	3	72928602	missense	probably benign
R4080:Sis	UTSW	3	72921184	missense	probably damaging	1.00
R4204:Sis	UTSW	3	72961082	missense	probably benign
R4394:Sis	UTSW	3	72956149	missense	probably damaging	1.00
R4470:Sis	UTSW	3	72928159	splice site	probably null
R4573:Sis	UTSW	3	72928237	missense	possibly damaging	0.94
R4868:Sis	UTSW	3	72943548	missense	probably benign	0.09
R5023:Sis	UTSW	3	72934122	missense	probably benign	0.05
R5264:Sis	UTSW	3	72949756	missense	probably damaging	0.98
R5414:Sis	UTSW	3	72952493	missense	probably benign
R5462:Sis	UTSW	3	72949838	missense	probably damaging	0.96
R5523:Sis	UTSW	3	72891421	missense	probably benign	0.00
R5584:Sis	UTSW	3	72910415	missense	probably damaging	1.00
R5587:Sis	UTSW	3	72914576	missense	possibly damaging	0.94
R5725:Sis	UTSW	3	72965598	missense	probably damaging	1.00
R5769:Sis	UTSW	3	72928235	missense	probably damaging	0.98
R5790:Sis	UTSW	3	72928174	missense	probably benign
R5864:Sis	UTSW	3	72949818	missense	probably damaging	1.00
R5902:Sis	UTSW	3	72960256	critical splice donor site	probably null
R5925:Sis	UTSW	3	72921380	splice site	probably null
R6018:Sis	UTSW	3	72913192	missense	possibly damaging	0.95
R6029:Sis	UTSW	3	72928308	missense	probably benign	0.30
R6124:Sis	UTSW	3	72953211	missense	possibly damaging	0.69
R6171:Sis	UTSW	3	72961027	missense	possibly damaging	0.75
R6182:Sis	UTSW	3	72904293	missense	probably benign	0.05
R6295:Sis	UTSW	3	72966770	missense	probably damaging	0.99
R6416:Sis	UTSW	3	72911854	missense	probably damaging	1.00
R6431:Sis	UTSW	3	72958174	missense	probably benign	0.00
R6472:Sis	UTSW	3	72938734	nonsense	probably null
R6517:Sis	UTSW	3	72907142	missense	probably damaging	1.00
R6701:Sis	UTSW	3	72949527	missense	probably damaging	1.00
R6796:Sis	UTSW	3	72965618	missense	probably benign	0.06
R6853:Sis	UTSW	3	72891426	missense	possibly damaging	0.93
R6906:Sis	UTSW	3	72919485	missense	probably damaging	1.00
R7058:Sis	UTSW	3	72903607	missense	probably damaging	0.98
R7357:Sis	UTSW	3	72925071	missense	probably damaging	1.00
R7381:Sis	UTSW	3	72913292	splice site	probably null
R7439:Sis	UTSW	3	72909041	missense	possibly damaging	0.81
R7742:Sis	UTSW	3	72925098	missense	probably benign	0.19
R7813:Sis	UTSW	3	72925468	missense	probably benign	0.01
R7883:Sis	UTSW	3	72920996	missense	possibly damaging	0.78
R7899:Sis	UTSW	3	72937251	missense	probably damaging	1.00
R7915:Sis	UTSW	3	72921138	missense	probably damaging	0.99
R7985:Sis	UTSW	3	72936961	splice site	probably null
R8020:Sis	UTSW	3	72908965	critical splice donor site	probably null
R8023:Sis	UTSW	3	72952480	missense	probably damaging	0.97
R8029:Sis	UTSW	3	72921142	missense	probably damaging	1.00
R8053:Sis	UTSW	3	72949568	nonsense	probably null
R8062:Sis	UTSW	3	72920988	nonsense	probably null
R8074:Sis	UTSW	3	72917198	missense	probably damaging	1.00
R8085:Sis	UTSW	3	72907129	missense	probably damaging	1.00
R8137:Sis	UTSW	3	72889045	missense	probably benign	0.22
R8349:Sis	UTSW	3	72903651	missense	probably damaging	1.00
R8354:Sis	UTSW	3	72947501	missense	possibly damaging	0.84
R8366:Sis	UTSW	3	72958233	missense	probably damaging	1.00
R8449:Sis	UTSW	3	72903651	missense	probably damaging	1.00
R8454:Sis	UTSW	3	72947501	missense	possibly damaging	0.84
R8474:Sis	UTSW	3	72929397	missense	probably damaging	1.00
R8515:Sis	UTSW	3	72929409	missense	probably benign	0.00
R8680:Sis	UTSW	3	72960295	missense	probably damaging	1.00
R8703:Sis	UTSW	3	72960324	missense	probably damaging	1.00
R9098:Sis	UTSW	3	72937245	missense	possibly damaging	0.66
R9466:Sis	UTSW	3	72965577	critical splice donor site	probably null
R9574:Sis	UTSW	3	72921157	missense	probably benign	0.05
R9630:Sis	UTSW	3	72921389	missense	probably benign	0.11
R9680:Sis	UTSW	3	72956288	missense	probably benign	0.12
R9709:Sis	UTSW	3	72891741	missense	possibly damaging	0.47
R9731:Sis	UTSW	3	72928210	missense	probably benign	0.01
X0009:Sis	UTSW	3	72889022	missense	probably damaging	0.99
X0024:Sis	UTSW	3	72928670	missense	probably benign
X0060:Sis	UTSW	3	72920906	intron	probably benign
Z1176:Sis	UTSW	3	72904273	missense	probably benign	0.05
Z1176:Sis	UTSW	3	72943557	missense	probably benign	0.25
Z1177:Sis	UTSW	3	72909172	missense	possibly damaging	0.88
Z1177:Sis	UTSW	3	72910474	missense	probably damaging	1.00
Z1177:Sis	UTSW	3	72943569	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACACTTTCAGGAAGGCATGGTAAGC -3'
(R):5'- TGTCAAACACCAGTTGCAGATCCTC -3'

Sequencing Primer
(F):5'- TGAGTTTGGATGGAAAGTAACCTC -3'
(R):5'- tataCTGACTGAAGCTTGATTTTGGG -3'

Posted On

2013-07-11