Incidental Mutation 'R7543:Wdfy3'
ID 584001
Institutional Source Beutler Lab
Gene Symbol Wdfy3
Ensembl Gene ENSMUSG00000043940
Gene Name WD repeat and FYVE domain containing 3
Synonyms 2610509D04Rik, Ggtb3, Bchs, D5Ertd66e, Bwf1, Alfy
MMRRC Submission 045615-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.943) question?
Stock # R7543 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 101980822-102217787 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 102083925 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Serine at position 787 (I787S)
Ref Sequence ENSEMBL: ENSMUSP00000052607 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053177] [ENSMUST00000174598] [ENSMUST00000174698] [ENSMUST00000212024]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000053177
AA Change: I787S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000052607
Gene: ENSMUSG00000043940
AA Change: I787S

DomainStartEndE-ValueType
low complexity region 463 481 N/A INTRINSIC
low complexity region 1408 1417 N/A INTRINSIC
low complexity region 1629 1644 N/A INTRINSIC
Pfam:PH_BEACH 2517 2638 3.1e-17 PFAM
Beach 2677 2958 2.54e-217 SMART
WD40 3054 3088 1.28e1 SMART
WD40 3098 3137 7.73e-6 SMART
WD40 3140 3178 8.29e-1 SMART
WD40 3183 3227 3.09e-1 SMART
low complexity region 3253 3274 N/A INTRINSIC
low complexity region 3307 3318 N/A INTRINSIC
WD40 3381 3420 1.33e1 SMART
FYVE 3428 3497 3.18e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174598
AA Change: I787S

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000134244
Gene: ENSMUSG00000043940
AA Change: I787S

DomainStartEndE-ValueType
low complexity region 463 481 N/A INTRINSIC
Pfam:DUF4704 1392 1597 6.6e-11 PFAM
low complexity region 1629 1644 N/A INTRINSIC
Pfam:PH_BEACH 2588 2656 1.8e-14 PFAM
Beach 2695 2976 2.54e-217 SMART
WD40 3072 3106 1.28e1 SMART
WD40 3116 3155 7.73e-6 SMART
WD40 3158 3196 8.29e-1 SMART
WD40 3201 3245 3.09e-1 SMART
low complexity region 3271 3292 N/A INTRINSIC
low complexity region 3325 3336 N/A INTRINSIC
WD40 3399 3438 1.33e1 SMART
FYVE 3446 3515 3.18e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174698
SMART Domains Protein: ENSMUSP00000134541
Gene: ENSMUSG00000043940

DomainStartEndE-ValueType
Blast:WD40 235 281 2e-21 BLAST
low complexity region 463 481 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000212024
AA Change: I787S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphatidylinositol 3-phosphate-binding protein that functions as a master conductor for aggregate clearance by autophagy. This protein shuttles from the nuclear membrane to colocalize with aggregated proteins, where it complexes with other autophagic components to achieve macroautophagy-mediated clearance of these aggregated proteins. However, it is not necessary for starvation-induced macroautophagy. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for hypomorphic mutations of this gene exhibit perinatal lethality, altered neural progenitor divisions and neuronal migration, a regionally enlarged cerebral cortex, and focal cortical dysplasias. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aacs T A 5: 125,559,920 (GRCm39) S54T probably damaging Het
Acsl5 G A 19: 55,266,615 (GRCm39) V59I Het
Acss2 A T 2: 155,391,755 (GRCm39) I203F probably damaging Het
Add2 A G 6: 86,083,207 (GRCm39) N435S probably damaging Het
Afap1l1 T C 18: 61,889,972 (GRCm39) D88G probably benign Het
Ajm1 C A 2: 25,467,410 (GRCm39) A834S possibly damaging Het
Ank3 C T 10: 69,786,846 (GRCm39) T970M possibly damaging Het
Ap3b2 A T 7: 81,115,894 (GRCm39) probably null Het
Apc2 A G 10: 80,150,720 (GRCm39) K1925E possibly damaging Het
Aspscr1 A G 11: 120,600,249 (GRCm39) N130D unknown Het
B3glct A G 5: 149,677,604 (GRCm39) D411G probably damaging Het
Bard1 T C 1: 71,114,589 (GRCm39) K131E probably damaging Het
Bche T C 3: 73,609,066 (GRCm39) D120G probably damaging Het
Brms1l A T 12: 55,914,997 (GRCm39) D302V probably damaging Het
Ccdc191 T A 16: 43,718,572 (GRCm39) Y56* probably null Het
Cela3a T A 4: 137,129,883 (GRCm39) H246L probably damaging Het
Col11a2 A T 17: 34,269,430 (GRCm39) D440V unknown Het
Cplane1 T C 15: 8,254,876 (GRCm39) I21T unknown Het
Dag1 C T 9: 108,095,280 (GRCm39) V71I probably benign Het
Ddx23 A G 15: 98,556,139 (GRCm39) S60P unknown Het
Dync1h1 G T 12: 110,580,541 (GRCm39) R134L probably benign Het
Dync1i1 T C 6: 5,784,464 (GRCm39) S103P possibly damaging Het
Erap1 T A 13: 74,822,753 (GRCm39) D755E probably damaging Het
Exosc8 T C 3: 54,636,669 (GRCm39) T221A probably benign Het
Fbxo4 T C 15: 4,007,385 (GRCm39) D93G probably damaging Het
Fzd5 A G 1: 64,774,999 (GRCm39) V254A probably damaging Het
Gbp3 T C 3: 142,272,341 (GRCm39) V281A probably damaging Het
Gcc2 T A 10: 58,107,086 (GRCm39) I774K probably benign Het
Gpr132 A C 12: 112,815,822 (GRCm39) C335G probably benign Het
Gpr162 G T 6: 124,838,355 (GRCm39) Y98* probably null Het
H2-T24 T C 17: 36,325,743 (GRCm39) T283A possibly damaging Het
Hoxc6 A G 15: 102,918,186 (GRCm39) Y50C probably damaging Het
Il4i1 A G 7: 44,486,199 (GRCm39) N53S possibly damaging Het
Iqcf3 T C 9: 106,431,425 (GRCm39) K60R possibly damaging Het
Kif24 A T 4: 41,413,993 (GRCm39) Y316* probably null Het
Krt18 A G 15: 101,939,896 (GRCm39) K365E probably damaging Het
Lrguk T A 6: 34,025,870 (GRCm39) L222* probably null Het
Mbd1 T G 18: 74,407,520 (GRCm39) V210G probably damaging Het
Ms4a6b A G 19: 11,499,155 (GRCm39) I90V not run Het
Muc16 A G 9: 18,556,028 (GRCm39) S3422P unknown Het
Mynn G A 3: 30,661,188 (GRCm39) W90* probably null Het
Or5p5 T A 7: 107,414,308 (GRCm39) N172K probably damaging Het
Pdpr T A 8: 111,859,520 (GRCm39) H687Q probably damaging Het
Pkd1 A G 17: 24,814,227 (GRCm39) E4199G probably damaging Het
Plekhg5 A G 4: 152,192,491 (GRCm39) E517G probably damaging Het
Plxna1 T C 6: 89,299,837 (GRCm39) D1644G probably damaging Het
Pon1 C T 6: 5,168,400 (GRCm39) V336M possibly damaging Het
Pop1 T A 15: 34,530,593 (GRCm39) L1027Q probably damaging Het
Pramel1 T C 4: 143,124,993 (GRCm39) S306P probably damaging Het
Prpsap2 A T 11: 61,635,797 (GRCm39) F168I possibly damaging Het
Rabgap1 T A 2: 37,359,444 (GRCm39) D2E probably damaging Het
Rgmb A T 17: 16,027,777 (GRCm39) L314Q probably damaging Het
Ryr2 C T 13: 11,653,317 (GRCm39) probably null Het
Samd4b A T 7: 28,113,711 (GRCm39) S85T probably benign Het
Sfrp5 T C 19: 42,187,302 (GRCm39) D256G possibly damaging Het
Slc25a23 A G 17: 57,365,106 (GRCm39) probably null Het
Sox5 A G 6: 143,786,905 (GRCm39) I589T probably damaging Het
Sybu T A 15: 44,546,848 (GRCm39) probably null Het
Syne2 A G 12: 75,953,616 (GRCm39) E515G possibly damaging Het
Tbc1d17 G A 7: 44,495,503 (GRCm39) A107V probably benign Het
Tcstv2c A C 13: 120,616,290 (GRCm39) E43A probably damaging Het
Tex50 G T 1: 160,984,817 (GRCm39) T141K possibly damaging Het
Tmc7 A G 7: 118,144,979 (GRCm39) L527P probably benign Het
Tns4 T A 11: 98,963,079 (GRCm39) D547V probably benign Het
Topors A G 4: 40,268,312 (GRCm39) S65P probably damaging Het
Trdc T A 14: 54,381,692 (GRCm39) S126T Het
Ttc27 A T 17: 75,024,745 (GRCm39) probably benign Het
Zc3h11a T C 1: 133,554,768 (GRCm39) D404G possibly damaging Het
Zfp799 A G 17: 33,039,534 (GRCm39) I244T probably benign Het
Zfp93 A G 7: 23,974,533 (GRCm39) T173A probably benign Het
Zfp953 T A 13: 67,495,953 (GRCm39) L29F probably damaging Het
Other mutations in Wdfy3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Wdfy3 APN 5 102,063,204 (GRCm39) critical splice donor site probably null
IGL00567:Wdfy3 APN 5 102,059,896 (GRCm39) splice site probably benign
IGL01288:Wdfy3 APN 5 102,049,857 (GRCm39) splice site probably null
IGL01323:Wdfy3 APN 5 102,042,930 (GRCm39) missense probably damaging 1.00
IGL01352:Wdfy3 APN 5 102,091,986 (GRCm39) missense probably damaging 1.00
IGL01553:Wdfy3 APN 5 102,047,897 (GRCm39) missense probably benign
IGL01560:Wdfy3 APN 5 102,105,352 (GRCm39) nonsense probably null
IGL01566:Wdfy3 APN 5 102,044,454 (GRCm39) splice site probably benign
IGL01616:Wdfy3 APN 5 102,061,126 (GRCm39) missense probably damaging 0.97
IGL01630:Wdfy3 APN 5 102,055,354 (GRCm39) missense probably benign
IGL01791:Wdfy3 APN 5 102,085,278 (GRCm39) missense probably damaging 1.00
IGL01820:Wdfy3 APN 5 102,071,947 (GRCm39) missense probably benign 0.11
IGL01953:Wdfy3 APN 5 102,042,894 (GRCm39) nonsense probably null
IGL02121:Wdfy3 APN 5 102,046,376 (GRCm39) missense possibly damaging 0.85
IGL02167:Wdfy3 APN 5 102,109,023 (GRCm39) missense probably damaging 0.98
IGL02321:Wdfy3 APN 5 102,070,475 (GRCm39) missense probably damaging 0.99
IGL02327:Wdfy3 APN 5 102,036,058 (GRCm39) missense probably damaging 1.00
IGL02651:Wdfy3 APN 5 102,044,341 (GRCm39) missense probably benign 0.37
IGL02801:Wdfy3 APN 5 102,055,453 (GRCm39) missense probably damaging 1.00
IGL02839:Wdfy3 APN 5 102,116,786 (GRCm39) missense probably damaging 1.00
IGL02870:Wdfy3 APN 5 102,003,337 (GRCm39) missense probably damaging 1.00
IGL02997:Wdfy3 APN 5 102,042,778 (GRCm39) missense probably null 1.00
IGL03064:Wdfy3 APN 5 102,083,863 (GRCm39) missense probably damaging 0.99
IGL03090:Wdfy3 APN 5 102,014,142 (GRCm39) missense probably damaging 1.00
IGL03211:Wdfy3 APN 5 101,992,778 (GRCm39) splice site probably benign
IGL03237:Wdfy3 APN 5 101,992,465 (GRCm39) missense probably damaging 1.00
IGL03264:Wdfy3 APN 5 102,048,016 (GRCm39) missense probably damaging 1.00
Esurient UTSW 5 102,091,969 (GRCm39) missense probably damaging 1.00
IGL02988:Wdfy3 UTSW 5 102,077,847 (GRCm39) missense probably damaging 0.99
PIT4382001:Wdfy3 UTSW 5 102,030,827 (GRCm39) frame shift probably null
R0010:Wdfy3 UTSW 5 101,996,215 (GRCm39) missense probably damaging 1.00
R0010:Wdfy3 UTSW 5 101,996,215 (GRCm39) missense probably damaging 1.00
R0025:Wdfy3 UTSW 5 101,992,912 (GRCm39) missense probably damaging 0.98
R0031:Wdfy3 UTSW 5 102,037,161 (GRCm39) missense probably damaging 0.97
R0047:Wdfy3 UTSW 5 102,091,899 (GRCm39) missense probably damaging 1.00
R0047:Wdfy3 UTSW 5 102,091,899 (GRCm39) missense probably damaging 1.00
R0053:Wdfy3 UTSW 5 101,992,480 (GRCm39) missense probably damaging 0.97
R0078:Wdfy3 UTSW 5 102,035,971 (GRCm39) missense possibly damaging 0.57
R0147:Wdfy3 UTSW 5 102,065,277 (GRCm39) missense probably benign 0.05
R0148:Wdfy3 UTSW 5 102,065,277 (GRCm39) missense probably benign 0.05
R0279:Wdfy3 UTSW 5 102,015,958 (GRCm39) missense probably damaging 1.00
R0380:Wdfy3 UTSW 5 102,096,832 (GRCm39) missense probably damaging 0.99
R0472:Wdfy3 UTSW 5 102,105,309 (GRCm39) missense probably benign 0.13
R0513:Wdfy3 UTSW 5 102,038,655 (GRCm39) missense probably damaging 0.96
R0594:Wdfy3 UTSW 5 102,054,051 (GRCm39) missense possibly damaging 0.94
R0601:Wdfy3 UTSW 5 101,984,038 (GRCm39) missense probably benign
R0787:Wdfy3 UTSW 5 102,105,254 (GRCm39) missense probably damaging 1.00
R0825:Wdfy3 UTSW 5 102,017,917 (GRCm39) missense probably damaging 1.00
R1122:Wdfy3 UTSW 5 102,030,832 (GRCm39) missense possibly damaging 0.94
R1167:Wdfy3 UTSW 5 102,023,797 (GRCm39) missense probably benign
R1350:Wdfy3 UTSW 5 102,046,418 (GRCm39) missense probably damaging 1.00
R1422:Wdfy3 UTSW 5 102,032,080 (GRCm39) splice site probably benign
R1446:Wdfy3 UTSW 5 101,999,176 (GRCm39) missense possibly damaging 0.68
R1452:Wdfy3 UTSW 5 102,085,604 (GRCm39) missense possibly damaging 0.91
R1457:Wdfy3 UTSW 5 102,065,445 (GRCm39) missense possibly damaging 0.57
R1543:Wdfy3 UTSW 5 101,991,947 (GRCm39) missense probably benign
R1633:Wdfy3 UTSW 5 102,129,414 (GRCm39) missense probably damaging 1.00
R1643:Wdfy3 UTSW 5 102,023,781 (GRCm39) missense possibly damaging 0.62
R1656:Wdfy3 UTSW 5 102,089,313 (GRCm39) missense probably damaging 1.00
R1720:Wdfy3 UTSW 5 102,074,391 (GRCm39) frame shift probably null
R1743:Wdfy3 UTSW 5 101,991,931 (GRCm39) missense probably benign 0.12
R1745:Wdfy3 UTSW 5 102,096,795 (GRCm39) missense probably damaging 0.96
R1850:Wdfy3 UTSW 5 102,042,865 (GRCm39) missense probably damaging 1.00
R1852:Wdfy3 UTSW 5 102,063,242 (GRCm39) missense probably benign 0.00
R1854:Wdfy3 UTSW 5 102,036,052 (GRCm39) missense probably benign 0.05
R1880:Wdfy3 UTSW 5 102,065,301 (GRCm39) missense probably benign 0.05
R1930:Wdfy3 UTSW 5 102,089,358 (GRCm39) missense probably damaging 1.00
R1931:Wdfy3 UTSW 5 102,089,358 (GRCm39) missense probably damaging 1.00
R1956:Wdfy3 UTSW 5 102,067,275 (GRCm39) missense probably benign 0.30
R1965:Wdfy3 UTSW 5 102,099,178 (GRCm39) missense probably damaging 1.00
R1997:Wdfy3 UTSW 5 102,116,812 (GRCm39) missense probably damaging 1.00
R2015:Wdfy3 UTSW 5 102,008,352 (GRCm39) missense probably null 1.00
R2087:Wdfy3 UTSW 5 102,042,926 (GRCm39) missense probably damaging 1.00
R2156:Wdfy3 UTSW 5 102,046,291 (GRCm39) critical splice donor site probably null
R2192:Wdfy3 UTSW 5 102,055,408 (GRCm39) missense possibly damaging 0.55
R2313:Wdfy3 UTSW 5 102,037,150 (GRCm39) missense probably damaging 1.00
R2332:Wdfy3 UTSW 5 102,036,189 (GRCm39) splice site probably benign
R2406:Wdfy3 UTSW 5 102,036,125 (GRCm39) missense probably damaging 1.00
R2679:Wdfy3 UTSW 5 102,017,902 (GRCm39) missense probably damaging 1.00
R2857:Wdfy3 UTSW 5 102,023,796 (GRCm39) missense probably benign 0.04
R2937:Wdfy3 UTSW 5 102,091,988 (GRCm39) missense probably benign 0.07
R3765:Wdfy3 UTSW 5 102,009,266 (GRCm39) missense probably damaging 1.00
R3795:Wdfy3 UTSW 5 102,085,466 (GRCm39) missense probably damaging 1.00
R3937:Wdfy3 UTSW 5 102,092,105 (GRCm39) nonsense probably null
R3947:Wdfy3 UTSW 5 102,017,902 (GRCm39) missense probably damaging 1.00
R4024:Wdfy3 UTSW 5 102,071,961 (GRCm39) splice site probably benign
R4065:Wdfy3 UTSW 5 102,070,313 (GRCm39) missense probably benign 0.08
R4066:Wdfy3 UTSW 5 102,070,313 (GRCm39) missense probably benign 0.08
R4110:Wdfy3 UTSW 5 102,047,924 (GRCm39) critical splice donor site probably null
R4235:Wdfy3 UTSW 5 102,070,500 (GRCm39) critical splice acceptor site probably null
R4420:Wdfy3 UTSW 5 102,058,850 (GRCm39) missense probably damaging 0.97
R4620:Wdfy3 UTSW 5 102,054,011 (GRCm39) missense probably damaging 0.99
R4624:Wdfy3 UTSW 5 102,031,949 (GRCm39) missense possibly damaging 0.52
R4626:Wdfy3 UTSW 5 102,091,800 (GRCm39) missense probably damaging 1.00
R4727:Wdfy3 UTSW 5 102,077,894 (GRCm39) missense probably damaging 0.99
R4794:Wdfy3 UTSW 5 102,091,809 (GRCm39) missense probably damaging 1.00
R4869:Wdfy3 UTSW 5 102,042,787 (GRCm39) missense probably damaging 0.98
R4971:Wdfy3 UTSW 5 102,096,838 (GRCm39) nonsense probably null
R4973:Wdfy3 UTSW 5 102,090,985 (GRCm39) missense probably benign 0.00
R4976:Wdfy3 UTSW 5 102,090,985 (GRCm39) missense probably benign 0.00
R4984:Wdfy3 UTSW 5 102,090,985 (GRCm39) missense probably benign 0.00
R4986:Wdfy3 UTSW 5 102,090,985 (GRCm39) missense probably benign 0.00
R5068:Wdfy3 UTSW 5 102,042,803 (GRCm39) missense probably benign 0.15
R5105:Wdfy3 UTSW 5 102,003,415 (GRCm39) missense probably damaging 1.00
R5120:Wdfy3 UTSW 5 102,015,972 (GRCm39) missense possibly damaging 0.85
R5134:Wdfy3 UTSW 5 102,091,969 (GRCm39) missense probably damaging 1.00
R5139:Wdfy3 UTSW 5 101,997,133 (GRCm39) critical splice donor site probably null
R5235:Wdfy3 UTSW 5 101,994,972 (GRCm39) missense probably null 0.03
R5303:Wdfy3 UTSW 5 102,100,849 (GRCm39) missense probably damaging 1.00
R5368:Wdfy3 UTSW 5 102,020,724 (GRCm39) missense probably damaging 1.00
R5426:Wdfy3 UTSW 5 102,067,312 (GRCm39) missense probably damaging 0.97
R5442:Wdfy3 UTSW 5 102,044,425 (GRCm39) missense probably benign 0.04
R5487:Wdfy3 UTSW 5 101,984,140 (GRCm39) missense probably damaging 1.00
R5509:Wdfy3 UTSW 5 102,009,314 (GRCm39) missense possibly damaging 0.69
R5877:Wdfy3 UTSW 5 102,017,855 (GRCm39) missense probably damaging 1.00
R5988:Wdfy3 UTSW 5 102,032,004 (GRCm39) missense probably benign 0.00
R6017:Wdfy3 UTSW 5 101,999,225 (GRCm39) missense probably benign 0.01
R6019:Wdfy3 UTSW 5 101,997,289 (GRCm39) missense probably damaging 1.00
R6199:Wdfy3 UTSW 5 102,020,831 (GRCm39) missense possibly damaging 0.93
R6228:Wdfy3 UTSW 5 102,046,295 (GRCm39) missense possibly damaging 0.67
R6258:Wdfy3 UTSW 5 102,020,831 (GRCm39) missense possibly damaging 0.93
R6259:Wdfy3 UTSW 5 102,020,831 (GRCm39) missense possibly damaging 0.93
R6298:Wdfy3 UTSW 5 102,116,812 (GRCm39) missense probably damaging 1.00
R6479:Wdfy3 UTSW 5 102,061,045 (GRCm39) missense probably damaging 1.00
R6550:Wdfy3 UTSW 5 102,101,032 (GRCm39) missense probably benign 0.19
R6776:Wdfy3 UTSW 5 102,031,911 (GRCm39) missense possibly damaging 0.57
R6793:Wdfy3 UTSW 5 102,065,297 (GRCm39) nonsense probably null
R6809:Wdfy3 UTSW 5 102,071,813 (GRCm39) missense possibly damaging 0.63
R6836:Wdfy3 UTSW 5 102,100,865 (GRCm39) missense probably damaging 1.00
R6897:Wdfy3 UTSW 5 101,991,932 (GRCm39) missense probably benign 0.10
R7014:Wdfy3 UTSW 5 102,042,775 (GRCm39) critical splice donor site probably null
R7034:Wdfy3 UTSW 5 102,055,384 (GRCm39) missense probably damaging 1.00
R7035:Wdfy3 UTSW 5 102,003,415 (GRCm39) missense probably damaging 1.00
R7135:Wdfy3 UTSW 5 102,063,303 (GRCm39) missense probably damaging 1.00
R7182:Wdfy3 UTSW 5 102,091,758 (GRCm39) missense possibly damaging 0.51
R7217:Wdfy3 UTSW 5 102,049,785 (GRCm39) missense probably damaging 1.00
R7236:Wdfy3 UTSW 5 101,984,074 (GRCm39) missense probably damaging 0.99
R7264:Wdfy3 UTSW 5 102,003,389 (GRCm39) missense probably benign 0.02
R7418:Wdfy3 UTSW 5 102,105,366 (GRCm39) missense probably benign 0.08
R7533:Wdfy3 UTSW 5 102,030,354 (GRCm39) missense probably benign 0.27
R7625:Wdfy3 UTSW 5 102,003,252 (GRCm39) splice site probably null
R7788:Wdfy3 UTSW 5 101,996,223 (GRCm39) missense probably damaging 0.99
R7810:Wdfy3 UTSW 5 102,099,265 (GRCm39) nonsense probably null
R7810:Wdfy3 UTSW 5 102,042,940 (GRCm39) missense probably benign 0.01
R8204:Wdfy3 UTSW 5 102,000,451 (GRCm39) missense probably benign 0.00
R8268:Wdfy3 UTSW 5 102,089,476 (GRCm39) missense probably damaging 1.00
R8286:Wdfy3 UTSW 5 102,085,287 (GRCm39) missense probably benign
R8507:Wdfy3 UTSW 5 102,020,767 (GRCm39) missense probably benign 0.05
R8514:Wdfy3 UTSW 5 101,999,219 (GRCm39) missense possibly damaging 0.92
R8536:Wdfy3 UTSW 5 102,033,064 (GRCm39) missense probably benign
R8710:Wdfy3 UTSW 5 102,030,349 (GRCm39) missense probably damaging 1.00
R8735:Wdfy3 UTSW 5 102,077,951 (GRCm39) missense probably benign 0.00
R8749:Wdfy3 UTSW 5 102,030,446 (GRCm39) missense probably damaging 1.00
R8931:Wdfy3 UTSW 5 102,065,421 (GRCm39) missense probably benign 0.11
R8943:Wdfy3 UTSW 5 101,993,231 (GRCm39) intron probably benign
R8968:Wdfy3 UTSW 5 102,011,983 (GRCm39) missense probably benign 0.05
R8979:Wdfy3 UTSW 5 102,096,764 (GRCm39) missense probably damaging 1.00
R8998:Wdfy3 UTSW 5 101,993,058 (GRCm39) missense probably benign 0.05
R9045:Wdfy3 UTSW 5 101,995,040 (GRCm39) missense probably damaging 1.00
R9068:Wdfy3 UTSW 5 102,000,451 (GRCm39) missense probably benign 0.34
R9105:Wdfy3 UTSW 5 102,030,512 (GRCm39) missense probably benign 0.05
R9122:Wdfy3 UTSW 5 102,091,831 (GRCm39) missense probably damaging 1.00
R9209:Wdfy3 UTSW 5 102,078,830 (GRCm39) missense probably benign 0.01
R9249:Wdfy3 UTSW 5 101,996,359 (GRCm39) missense possibly damaging 0.82
R9348:Wdfy3 UTSW 5 102,089,358 (GRCm39) missense probably damaging 1.00
R9481:Wdfy3 UTSW 5 102,000,478 (GRCm39) missense probably benign 0.19
R9490:Wdfy3 UTSW 5 102,078,716 (GRCm39) missense probably benign 0.29
R9524:Wdfy3 UTSW 5 102,055,333 (GRCm39) missense probably benign 0.03
R9545:Wdfy3 UTSW 5 102,100,957 (GRCm39) missense
R9548:Wdfy3 UTSW 5 102,033,059 (GRCm39) missense probably damaging 0.99
R9636:Wdfy3 UTSW 5 102,047,899 (GRCm39) missense probably benign
R9750:Wdfy3 UTSW 5 102,077,960 (GRCm39) missense probably benign 0.00
R9766:Wdfy3 UTSW 5 102,042,866 (GRCm39) missense possibly damaging 0.90
R9771:Wdfy3 UTSW 5 102,000,195 (GRCm39) missense probably damaging 1.00
Z1177:Wdfy3 UTSW 5 102,048,107 (GRCm39) missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- AACATAAGCAAGAGCCCTGTG -3'
(R):5'- AAGGTCCGTGTTAACATTGGTAG -3'

Sequencing Primer
(F):5'- AAGAGCCCTGTGTCCCAC -3'
(R):5'- AACATTGGTAGGAGCGGCTTC -3'
Posted On 2019-10-17