Incidental Mutation 'R7543:Muc16'
ID584018
Institutional Source Beutler Lab
Gene Symbol Muc16
Ensembl Gene ENSMUSG00000109564
Gene Namemucin 16
Synonyms1110008I14Rik, LOC385009
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.200) question?
Stock #R7543 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location18495455-18674530 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 18644732 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 3422 (S3422P)
Ref Sequence ENSEMBL: ENSMUSP00000147104 (fasta)
Predicted Effect unknown
Transcript: ENSMUST00000208663
AA Change: S3422P
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice are viable and fertile with no gross histological abnormalities. Homozygous male mice father larger litters when crossed to wild-type females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,225,392 I21T unknown Het
Aacs T A 5: 125,482,856 S54T probably damaging Het
Acsl5 G A 19: 55,278,183 V59I Het
Acss2 A T 2: 155,549,835 I203F probably damaging Het
Add2 A G 6: 86,106,225 N435S probably damaging Het
Afap1l1 T C 18: 61,756,901 D88G probably benign Het
Ank3 C T 10: 69,951,016 T970M possibly damaging Het
Ap3b2 A T 7: 81,466,146 probably null Het
Apc2 A G 10: 80,314,886 K1925E possibly damaging Het
Aspscr1 A G 11: 120,709,423 N130D unknown Het
B3glct A G 5: 149,754,139 D411G probably damaging Het
Bard1 T C 1: 71,075,430 K131E probably damaging Het
Bche T C 3: 73,701,733 D120G probably damaging Het
Brms1l A T 12: 55,868,212 D302V probably damaging Het
Ccdc191 T A 16: 43,898,209 Y56* probably null Het
Cela3a T A 4: 137,402,572 H246L probably damaging Het
Col11a2 A T 17: 34,050,456 D440V unknown Het
Dag1 C T 9: 108,218,081 V71I probably benign Het
Ddx23 A G 15: 98,658,258 S60P unknown Het
Dync1h1 G T 12: 110,614,107 R134L probably benign Het
Dync1i1 T C 6: 5,784,464 S103P possibly damaging Het
Erap1 T A 13: 74,674,634 D755E probably damaging Het
Exosc8 T C 3: 54,729,248 T221A probably benign Het
Fbxo4 T C 15: 3,977,903 D93G probably damaging Het
Fzd5 A G 1: 64,735,840 V254A probably damaging Het
Gbp3 T C 3: 142,566,580 V281A probably damaging Het
Gcc2 T A 10: 58,271,264 I774K probably benign Het
Gm20767 A C 13: 120,154,754 E43A probably damaging Het
Gm996 C A 2: 25,577,398 A834S possibly damaging Het
Gpr132 A C 12: 112,852,202 C335G probably benign Het
Gpr162 G T 6: 124,861,392 Y98* probably null Het
H2-T24 T C 17: 36,014,851 T283A possibly damaging Het
Hoxc6 A G 15: 103,009,754 Y50C probably damaging Het
Il4i1 A G 7: 44,836,775 N53S possibly damaging Het
Iqcf3 T C 9: 106,554,226 K60R possibly damaging Het
Kif24 A T 4: 41,413,993 Y316* probably null Het
Krt18 A G 15: 102,031,461 K365E probably damaging Het
Lrguk T A 6: 34,048,935 L222* probably null Het
Mbd1 T G 18: 74,274,449 V210G probably damaging Het
Ms4a6b A G 19: 11,521,791 I90V not run Het
Mynn G A 3: 30,607,039 W90* probably null Het
Olfr467 T A 7: 107,815,101 N172K probably damaging Het
Pdpr T A 8: 111,132,888 H687Q probably damaging Het
Pkd1 A G 17: 24,595,253 E4199G probably damaging Het
Plekhg5 A G 4: 152,108,034 E517G probably damaging Het
Plxna1 T C 6: 89,322,855 D1644G probably damaging Het
Pon1 C T 6: 5,168,400 V336M possibly damaging Het
Pop1 T A 15: 34,530,447 L1027Q probably damaging Het
Pramel1 T C 4: 143,398,423 S306P probably damaging Het
Prpsap2 A T 11: 61,744,971 F168I possibly damaging Het
Rabgap1 T A 2: 37,469,432 D2E probably damaging Het
Rgmb A T 17: 15,807,515 L314Q probably damaging Het
Ryr2 C T 13: 11,638,431 probably null Het
Samd4b A T 7: 28,414,286 S85T probably benign Het
Sfrp5 T C 19: 42,198,863 D256G possibly damaging Het
Slc25a23 A G 17: 57,058,106 probably null Het
Sox5 A G 6: 143,841,179 I589T probably damaging Het
Sybu T A 15: 44,683,452 probably null Het
Syne2 A G 12: 75,906,842 E515G possibly damaging Het
Tbc1d17 G A 7: 44,846,079 A107V probably benign Het
Tex50 G T 1: 161,157,247 T141K possibly damaging Het
Tmc7 A G 7: 118,545,756 L527P probably benign Het
Tns4 T A 11: 99,072,253 D547V probably benign Het
Topors A G 4: 40,268,312 S65P probably damaging Het
Trdc T A 14: 54,144,235 S126T Het
Ttc27 A T 17: 74,717,750 probably benign Het
Wdfy3 A C 5: 101,936,059 I787S probably benign Het
Zc3h11a T C 1: 133,627,030 D404G possibly damaging Het
Zfp799 A G 17: 32,820,560 I244T probably benign Het
Zfp93 A G 7: 24,275,108 T173A probably benign Het
Zfp953 T A 13: 67,347,889 L29F probably damaging Het
Other mutations in Muc16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01330:Muc16 APN 9 18508507 missense possibly damaging 0.89
IGL01878:Muc16 APN 9 18495543 missense possibly damaging 0.90
IGL02394:Muc16 APN 9 18498700 missense probably damaging 0.99
IGL02553:Muc16 APN 9 18498553 critical splice donor site probably null
R0400:Muc16 UTSW 9 18510534 missense possibly damaging 0.74
R1620:Muc16 UTSW 9 18510477 missense possibly damaging 0.89
R1695:Muc16 UTSW 9 18497433 missense probably damaging 1.00
R3196:Muc16 UTSW 9 18497830 missense probably damaging 1.00
R5982:Muc16 UTSW 9 18647146 missense unknown
R5990:Muc16 UTSW 9 18659243 missense unknown
R6024:Muc16 UTSW 9 18646671 missense unknown
R6026:Muc16 UTSW 9 18659858 missense unknown
R6028:Muc16 UTSW 9 18657176 missense unknown
R6083:Muc16 UTSW 9 18657212 missense unknown
R6089:Muc16 UTSW 9 18643252 missense unknown
R6109:Muc16 UTSW 9 18655359 missense unknown
R6127:Muc16 UTSW 9 18657878 missense unknown
R6130:Muc16 UTSW 9 18590698 missense probably damaging 1.00
R6146:Muc16 UTSW 9 18497797 missense probably damaging 0.98
R6161:Muc16 UTSW 9 18647818 missense unknown
R6164:Muc16 UTSW 9 18558379 missense probably damaging 1.00
R6185:Muc16 UTSW 9 18654473 missense unknown
R6192:Muc16 UTSW 9 18658689 missense unknown
R6217:Muc16 UTSW 9 18655446 missense unknown
R6232:Muc16 UTSW 9 18656998 missense unknown
R6246:Muc16 UTSW 9 18577067 intron probably null
R6255:Muc16 UTSW 9 18655599 missense unknown
R6280:Muc16 UTSW 9 18579317 critical splice donor site probably null
R6286:Muc16 UTSW 9 18644389 missense unknown
R6287:Muc16 UTSW 9 18659034 missense unknown
R6307:Muc16 UTSW 9 18647588 missense unknown
R6310:Muc16 UTSW 9 18641950 missense probably benign 0.00
R6316:Muc16 UTSW 9 18641819 missense probably benign 0.01
R6335:Muc16 UTSW 9 18660708 missense unknown
R6345:Muc16 UTSW 9 18654926 missense unknown
R6349:Muc16 UTSW 9 18657329 missense unknown
R6366:Muc16 UTSW 9 18646044 missense unknown
R6393:Muc16 UTSW 9 18647399 nonsense probably null
R6440:Muc16 UTSW 9 18641359 missense probably benign 0.01
R6458:Muc16 UTSW 9 18641721 missense probably benign 0.01
R6460:Muc16 UTSW 9 18640516 missense probably benign 0.01
R6481:Muc16 UTSW 9 18550677 critical splice donor site probably null
R6539:Muc16 UTSW 9 18637325 missense probably benign 0.25
R6551:Muc16 UTSW 9 18562562 missense possibly damaging 0.95
R6596:Muc16 UTSW 9 18566715 missense probably benign 0.18
R6601:Muc16 UTSW 9 18637570 missense probably benign 0.10
R6602:Muc16 UTSW 9 18609476 intron probably null
R6615:Muc16 UTSW 9 18647188 missense unknown
R6625:Muc16 UTSW 9 18660278 missense unknown
R6668:Muc16 UTSW 9 18640385 missense probably benign 0.03
R6697:Muc16 UTSW 9 18641291 missense probably benign 0.01
R6710:Muc16 UTSW 9 18642070 missense possibly damaging 0.95
R6727:Muc16 UTSW 9 18566690 critical splice donor site probably null
R6789:Muc16 UTSW 9 18559986 missense probably benign 0.40
R6806:Muc16 UTSW 9 18537910 critical splice donor site probably null
R6874:Muc16 UTSW 9 18658769 nonsense probably null
R6894:Muc16 UTSW 9 18495576 missense possibly damaging 0.92
R6913:Muc16 UTSW 9 18642663 missense unknown
R6919:Muc16 UTSW 9 18660299 missense unknown
R6939:Muc16 UTSW 9 18638537 missense probably benign 0.04
R6953:Muc16 UTSW 9 18640529 missense probably benign 0.01
R6956:Muc16 UTSW 9 18645026 missense unknown
R6977:Muc16 UTSW 9 18645337 missense unknown
R6996:Muc16 UTSW 9 18645897 missense unknown
R7011:Muc16 UTSW 9 18637451 missense probably benign 0.26
R7011:Muc16 UTSW 9 18637543 missense probably benign 0.10
R7012:Muc16 UTSW 9 18495618 critical splice acceptor site probably null
R7014:Muc16 UTSW 9 18658236 missense unknown
R7021:Muc16 UTSW 9 18554919 missense unknown
R7021:Muc16 UTSW 9 18550831 splice site probably null
R7038:Muc16 UTSW 9 18620468 missense probably damaging 0.99
R7057:Muc16 UTSW 9 18646079 missense unknown
R7058:Muc16 UTSW 9 18639755 missense probably benign 0.10
R7066:Muc16 UTSW 9 18658021 missense unknown
R7067:Muc16 UTSW 9 18658251 missense unknown
R7070:Muc16 UTSW 9 18645923 nonsense probably null
R7074:Muc16 UTSW 9 18655650 missense unknown
R7085:Muc16 UTSW 9 18644849 missense unknown
R7088:Muc16 UTSW 9 18592680 missense probably damaging 0.99
R7107:Muc16 UTSW 9 18637298 missense probably benign 0.10
R7108:Muc16 UTSW 9 18655233 missense unknown
R7126:Muc16 UTSW 9 18641216 missense probably benign 0.01
R7128:Muc16 UTSW 9 18643004 missense unknown
R7145:Muc16 UTSW 9 18655580 missense unknown
R7179:Muc16 UTSW 9 18642008 missense probably benign 0.00
R7194:Muc16 UTSW 9 18674454 missense unknown
R7211:Muc16 UTSW 9 18498570 missense probably damaging 1.00
R7213:Muc16 UTSW 9 18641416 missense probably benign 0.01
R7217:Muc16 UTSW 9 18644076 nonsense probably null
R7221:Muc16 UTSW 9 18642199 missense probably benign 0.04
R7265:Muc16 UTSW 9 18656472 missense unknown
R7326:Muc16 UTSW 9 18585013 missense probably benign 0.03
R7359:Muc16 UTSW 9 18643020 missense unknown
R7387:Muc16 UTSW 9 18641720 missense probably benign 0.01
R7391:Muc16 UTSW 9 18639536 missense probably benign 0.04
R7398:Muc16 UTSW 9 18637742 missense possibly damaging 0.46
R7419:Muc16 UTSW 9 18641962 missense probably benign 0.01
R7431:Muc16 UTSW 9 18607993 missense
R7484:Muc16 UTSW 9 18646768 missense unknown
R7487:Muc16 UTSW 9 18584799 missense possibly damaging 0.93
R7497:Muc16 UTSW 9 18645089 missense unknown
R7515:Muc16 UTSW 9 18639662 missense probably benign 0.00
R7537:Muc16 UTSW 9 18638135 missense probably benign 0.06
R7538:Muc16 UTSW 9 18642131 missense probably benign 0.10
R7538:Muc16 UTSW 9 18655451 missense unknown
R7566:Muc16 UTSW 9 18638629 missense probably benign 0.00
R7581:Muc16 UTSW 9 18645614 missense unknown
R7594:Muc16 UTSW 9 18645062 missense unknown
R7629:Muc16 UTSW 9 18566785 missense possibly damaging 0.86
R7664:Muc16 UTSW 9 18607722 missense probably benign 0.08
R7666:Muc16 UTSW 9 18558427 missense probably damaging 1.00
R7703:Muc16 UTSW 9 18605282 missense
R7727:Muc16 UTSW 9 18660242 missense unknown
Predicted Primers PCR Primer
(F):5'- AACTGTGGCATGTAGTTCAGAAG -3'
(R):5'- TGGGTCTCCTATCAGGCAAAAG -3'

Sequencing Primer
(F):5'- GTCATCATTTTTGGTGCACTAGAAG -3'
(R):5'- GTCTCCTATCAGGCAAAAGAAGGAC -3'
Posted On2019-10-17