Incidental Mutation 'R0617:Col24a1'
ID 58403
Institutional Source Beutler Lab
Gene Symbol Col24a1
Ensembl Gene ENSMUSG00000028197
Gene Name collagen, type XXIV, alpha 1
Synonyms 5430404K19Rik
MMRRC Submission 038806-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0617 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 144998233-145257766 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 145019881 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 84 (V84A)
Ref Sequence ENSEMBL: ENSMUSP00000029848 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029848] [ENSMUST00000139001]
AlphaFold Q30D77
Predicted Effect probably damaging
Transcript: ENSMUST00000029848
AA Change: V84A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000029848
Gene: ENSMUSG00000028197
AA Change: V84A

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
TSPN 41 230 2.7e-3 SMART
LamG 106 229 8.07e-2 SMART
Pfam:Collagen 506 565 9.6e-10 PFAM
Pfam:Collagen 561 623 3.4e-10 PFAM
Pfam:Collagen 604 678 2.3e-9 PFAM
low complexity region 682 724 N/A INTRINSIC
Pfam:Collagen 772 837 1.3e-10 PFAM
Pfam:Collagen 865 938 6e-9 PFAM
Pfam:Collagen 967 1042 3.1e-8 PFAM
low complexity region 1056 1075 N/A INTRINSIC
Pfam:Collagen 1107 1180 8e-9 PFAM
Pfam:Collagen 1159 1218 4.2e-10 PFAM
Pfam:Collagen 1218 1279 1.8e-10 PFAM
Pfam:Collagen 1270 1334 3.1e-9 PFAM
Pfam:Collagen 1378 1443 1.3e-9 PFAM
Pfam:Collagen 1439 1500 1.8e-9 PFAM
COLFI 1533 1733 9.34e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139001
Meta Mutation Damage Score 0.6199 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.5%
Validation Efficiency 98% (130/133)
MGI Phenotype FUNCTION: This gene encodes the alpha-1 subunit of type XXIV collagen, one of the low abundance fibril-forming collagens found in cartilage. The encoded protein has structural features of invertebrate fibrillar collagens and is expressed predominantly in bone tissue. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 130 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930555F03Rik A T 8: 49,953,527 (GRCm39) noncoding transcript Het
A630073D07Rik T C 6: 132,603,700 (GRCm39) probably benign Het
Abca16 G A 7: 120,032,834 (GRCm39) probably benign Het
Abca5 A T 11: 110,170,515 (GRCm39) D1265E probably damaging Het
Abcf1 C T 17: 36,272,079 (GRCm39) V312I probably benign Het
Abhd12 T A 2: 150,688,285 (GRCm39) probably null Het
Adam23 A G 1: 63,582,306 (GRCm39) H318R probably benign Het
Adcy2 T A 13: 68,826,725 (GRCm39) K660* probably null Het
Adgrf3 T C 5: 30,400,078 (GRCm39) T972A probably benign Het
Adipoq T A 16: 22,974,160 (GRCm39) D62E probably damaging Het
Alk G T 17: 72,910,578 (GRCm39) P43T probably damaging Het
Arap2 AT ATT 5: 62,807,250 (GRCm39) probably benign Het
Arhgef28 G T 13: 98,106,863 (GRCm39) T687K probably benign Het
Arrb1 T C 7: 99,243,884 (GRCm39) L278P probably damaging Het
Atad2b C A 12: 4,987,401 (GRCm39) D76E probably benign Het
Atm A T 9: 53,370,241 (GRCm39) Y2290* probably null Het
Atrn T A 2: 130,837,005 (GRCm39) probably null Het
Bpifb1 A G 2: 154,054,867 (GRCm39) D253G possibly damaging Het
Bpifb9b C T 2: 154,161,545 (GRCm39) T559M probably benign Het
Bsn T C 9: 107,984,439 (GRCm39) E3205G unknown Het
Cacna1c T C 6: 118,579,174 (GRCm39) Y1599C probably damaging Het
Ccdc40 A G 11: 119,133,630 (GRCm39) D590G probably damaging Het
Ccdc68 A G 18: 70,079,623 (GRCm39) probably null Het
Ccdc97 G A 7: 25,413,845 (GRCm39) R279C probably damaging Het
Ccm2l A G 2: 152,912,820 (GRCm39) T120A probably damaging Het
Cfap54 T C 10: 92,665,512 (GRCm39) probably benign Het
Cfh A G 1: 140,028,621 (GRCm39) S1043P probably benign Het
Chil3 T C 3: 106,063,072 (GRCm39) K173E probably benign Het
Cib2 T C 9: 54,461,780 (GRCm39) D26G possibly damaging Het
Csn3 T C 5: 88,077,730 (GRCm39) Y79H probably benign Het
Ddx47 T A 6: 134,994,085 (GRCm39) V149E probably damaging Het
Dennd5b A T 6: 148,934,760 (GRCm39) probably benign Het
Desi1 T C 15: 81,882,399 (GRCm39) N109D probably damaging Het
Fam13c T C 10: 70,372,182 (GRCm39) probably benign Het
Fam234a A T 17: 26,435,591 (GRCm39) D264E probably benign Het
Fanca A G 8: 124,014,809 (GRCm39) F831S probably damaging Het
Fancm C T 12: 65,144,091 (GRCm39) R518* probably null Het
Fat2 A G 11: 55,202,669 (GRCm39) V135A possibly damaging Het
Fbxl17 A C 17: 63,691,987 (GRCm39) F42V probably damaging Het
Fgd3 A T 13: 49,418,173 (GRCm39) V631E possibly damaging Het
Fhod3 G A 18: 25,245,736 (GRCm39) probably benign Het
Focad T C 4: 88,039,525 (GRCm39) probably benign Het
Foxn4 C A 5: 114,399,129 (GRCm39) probably benign Het
Gm2381 A T 7: 42,469,402 (GRCm39) C241S probably damaging Het
Gm6483 T G 8: 19,743,725 (GRCm39) F117V probably damaging Het
Hectd4 T C 5: 121,481,295 (GRCm39) probably benign Het
Hecw1 T A 13: 14,455,027 (GRCm39) Q676L probably benign Het
Hipk2 G A 6: 38,724,420 (GRCm39) R437C possibly damaging Het
Ifnar1 T C 16: 91,298,570 (GRCm39) Y396H probably damaging Het
Ints5 A T 19: 8,873,383 (GRCm39) K447N probably damaging Het
Iqsec1 T C 6: 90,666,952 (GRCm39) Y495C probably damaging Het
Itga5 C T 15: 103,264,742 (GRCm39) probably null Het
Kcnk4 T A 19: 6,905,528 (GRCm39) probably benign Het
Kmo A G 1: 175,474,756 (GRCm39) T174A possibly damaging Het
Krt36 T C 11: 99,993,101 (GRCm39) D458G probably damaging Het
Krtap16-1 G T 11: 99,877,321 (GRCm39) P28T probably damaging Het
Lama3 T C 18: 12,552,315 (GRCm39) probably null Het
Lrrc9 T C 12: 72,529,788 (GRCm39) S920P probably damaging Het
Lrrk2 A T 15: 91,636,481 (GRCm39) Y1485F probably benign Het
Mical1 C T 10: 41,357,311 (GRCm39) A372V probably damaging Het
Ms4a20 C A 19: 11,089,764 (GRCm39) L40F probably damaging Het
Mtr C T 13: 12,236,318 (GRCm39) R636Q probably benign Het
Muc4 A T 16: 32,570,925 (GRCm39) T662S possibly damaging Het
Myo10 G A 15: 25,738,091 (GRCm39) V546M probably damaging Het
Nbeal1 G A 1: 60,320,991 (GRCm39) W2034* probably null Het
Nhlrc3 T C 3: 53,366,044 (GRCm39) T150A probably damaging Het
Nicol1 T C 5: 34,140,896 (GRCm39) probably benign Het
Nkx2-1 T C 12: 56,581,640 (GRCm39) H69R possibly damaging Het
Nlrp4g A T 9: 124,349,540 (GRCm38) noncoding transcript Het
Nod2 A G 8: 89,379,859 (GRCm39) N120S probably benign Het
Nol8 T C 13: 49,807,921 (GRCm39) F46L possibly damaging Het
Ntrk1 T C 3: 87,691,240 (GRCm39) D308G possibly damaging Het
Oog3 A T 4: 143,886,784 (GRCm39) V112D probably benign Het
Or10ag58 A G 2: 87,265,005 (GRCm39) D58G probably damaging Het
Or4a66 A G 2: 88,531,040 (GRCm39) V211A probably damaging Het
Or51i1 A T 7: 103,671,196 (GRCm39) S110T probably damaging Het
Or5af2 T C 11: 58,707,975 (GRCm39) V47A probably damaging Het
Or5b106 T C 19: 13,123,727 (GRCm39) M99V probably benign Het
Or5b120 C A 19: 13,479,900 (GRCm39) N64K probably damaging Het
Or5m9b A G 2: 85,905,485 (GRCm39) M134V probably benign Het
Or9s18 A T 13: 65,300,692 (GRCm39) Y218F possibly damaging Het
Pakap T C 4: 57,829,434 (GRCm39) probably benign Het
Pcdhb8 C T 18: 37,490,100 (GRCm39) R593C probably benign Het
Pgm3 A G 9: 86,438,243 (GRCm39) probably null Het
Pirt T A 11: 66,816,998 (GRCm39) V103E probably damaging Het
Plxnc1 T A 10: 94,635,230 (GRCm39) D1332V probably damaging Het
Ppfia4 A T 1: 134,256,518 (GRCm39) V122E probably damaging Het
Pramel14 A G 4: 143,720,088 (GRCm39) probably benign Het
Prmt2 C T 10: 76,044,517 (GRCm39) probably benign Het
Prrc2a G T 17: 35,372,536 (GRCm39) P1702T probably damaging Het
Prss39 A T 1: 34,539,279 (GRCm39) H173L probably damaging Het
Rabl6 A G 2: 25,476,878 (GRCm39) probably null Het
Rb1cc1 T A 1: 6,319,014 (GRCm39) I794K possibly damaging Het
Reln T C 5: 22,125,535 (GRCm39) D2716G probably damaging Het
Sbf2 ACC AC 7: 109,929,890 (GRCm39) probably null Het
Sema6d T A 2: 124,502,665 (GRCm39) F583L possibly damaging Het
Setx T A 2: 29,036,819 (GRCm39) H1101Q possibly damaging Het
Sis A G 3: 72,872,938 (GRCm39) C67R probably damaging Het
Skint1 T A 4: 111,886,596 (GRCm39) probably benign Het
Smg6 C A 11: 75,053,757 (GRCm39) T1413K probably benign Het
Spata31d1a A T 13: 59,850,073 (GRCm39) I685N possibly damaging Het
Spef2 T A 15: 9,592,844 (GRCm39) N1499I probably damaging Het
Stk11ip T A 1: 75,508,932 (GRCm39) probably null Het
Stxbp1 A C 2: 32,692,795 (GRCm39) I407S probably damaging Het
Svil T C 18: 5,117,002 (GRCm39) S2059P probably damaging Het
Syne1 C T 10: 5,300,933 (GRCm39) V932M probably damaging Het
Tacc1 A C 8: 25,668,020 (GRCm39) probably benign Het
Tbc1d13 C A 2: 30,025,576 (GRCm39) probably benign Het
Tbc1d15 A C 10: 115,075,204 (GRCm39) D59E probably damaging Het
Tcaf2 A G 6: 42,619,445 (GRCm39) F194S probably damaging Het
Terf2ip T A 8: 112,738,127 (GRCm39) M5K probably benign Het
Tgfbr2 A T 9: 115,987,388 (GRCm39) D40E probably benign Het
Tm4sf5 T A 11: 70,401,495 (GRCm39) S165T probably damaging Het
Tmprss3 A T 17: 31,412,886 (GRCm39) C129S probably damaging Het
Tmx2 T C 2: 84,502,740 (GRCm39) D256G probably benign Het
Tnr A G 1: 159,695,673 (GRCm39) D532G probably damaging Het
Tnrc18 T A 5: 142,762,494 (GRCm39) H465L unknown Het
Togaram2 A T 17: 72,007,504 (GRCm39) Q350L possibly damaging Het
Topaz1 G A 9: 122,578,971 (GRCm39) C627Y possibly damaging Het
Tpx2 A T 2: 152,715,058 (GRCm39) Q93L probably benign Het
Trim54 T C 5: 31,293,526 (GRCm39) probably null Het
Troap T A 15: 98,980,541 (GRCm39) C574S probably damaging Het
Tut7 A T 13: 59,964,669 (GRCm39) probably null Het
Ubr4 T C 4: 139,206,373 (GRCm39) probably null Het
Vmn2r51 A G 7: 9,834,396 (GRCm39) V214A possibly damaging Het
Vmn2r66 A T 7: 84,644,484 (GRCm39) M642K probably benign Het
Vwa5a T A 9: 38,635,191 (GRCm39) I232N probably damaging Het
Zfp820 A T 17: 22,038,685 (GRCm39) S214R probably damaging Het
Zfp955b A T 17: 33,524,437 (GRCm39) S43R probably damaging Het
Zgrf1 C T 3: 127,381,687 (GRCm39) T1162M probably benign Het
Other mutations in Col24a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Col24a1 APN 3 145,068,064 (GRCm39) missense probably damaging 1.00
IGL00931:Col24a1 APN 3 145,167,225 (GRCm39) missense probably benign 0.00
IGL01160:Col24a1 APN 3 145,213,468 (GRCm39) missense probably damaging 1.00
IGL01355:Col24a1 APN 3 145,020,637 (GRCm39) missense probably benign 0.07
IGL01409:Col24a1 APN 3 145,244,319 (GRCm39) missense probably benign 0.19
IGL01587:Col24a1 APN 3 145,139,110 (GRCm39) splice site probably null
IGL01666:Col24a1 APN 3 145,050,447 (GRCm39) missense possibly damaging 0.93
IGL01717:Col24a1 APN 3 145,230,018 (GRCm39) splice site probably benign
IGL01721:Col24a1 APN 3 145,244,322 (GRCm39) missense probably benign 0.26
IGL01939:Col24a1 APN 3 145,021,005 (GRCm39) missense probably damaging 1.00
IGL01988:Col24a1 APN 3 145,229,922 (GRCm39) splice site probably null
IGL02002:Col24a1 APN 3 145,062,699 (GRCm39) missense possibly damaging 0.81
IGL02172:Col24a1 APN 3 145,020,723 (GRCm39) missense probably benign 0.34
IGL02552:Col24a1 APN 3 145,179,962 (GRCm39) missense possibly damaging 0.88
IGL02559:Col24a1 APN 3 145,019,934 (GRCm39) missense probably benign
IGL02582:Col24a1 APN 3 145,020,247 (GRCm39) missense probably damaging 1.00
IGL02652:Col24a1 APN 3 145,198,056 (GRCm39) nonsense probably null
IGL02942:Col24a1 APN 3 145,247,420 (GRCm39) missense probably damaging 1.00
IGL03032:Col24a1 APN 3 145,244,458 (GRCm39) critical splice donor site probably null
IGL03108:Col24a1 APN 3 145,029,162 (GRCm39) missense probably damaging 1.00
IGL03310:Col24a1 APN 3 145,019,744 (GRCm39) splice site probably benign
IGL03405:Col24a1 APN 3 145,020,918 (GRCm39) missense possibly damaging 0.73
R0066:Col24a1 UTSW 3 145,250,899 (GRCm39) missense probably damaging 1.00
R0066:Col24a1 UTSW 3 145,250,899 (GRCm39) missense probably damaging 1.00
R0379:Col24a1 UTSW 3 145,229,897 (GRCm39) missense possibly damaging 0.94
R0502:Col24a1 UTSW 3 145,251,071 (GRCm39) splice site probably benign
R0556:Col24a1 UTSW 3 145,020,489 (GRCm39) missense possibly damaging 0.53
R0587:Col24a1 UTSW 3 144,998,906 (GRCm39) missense possibly damaging 0.50
R0831:Col24a1 UTSW 3 145,034,520 (GRCm39) missense probably damaging 1.00
R1455:Col24a1 UTSW 3 145,166,593 (GRCm39) missense probably damaging 1.00
R1664:Col24a1 UTSW 3 145,095,355 (GRCm39) critical splice donor site probably null
R1713:Col24a1 UTSW 3 145,072,624 (GRCm39) nonsense probably null
R1854:Col24a1 UTSW 3 145,164,895 (GRCm39) missense probably damaging 1.00
R1855:Col24a1 UTSW 3 145,164,895 (GRCm39) missense probably damaging 1.00
R1861:Col24a1 UTSW 3 145,243,022 (GRCm39) critical splice donor site probably null
R1969:Col24a1 UTSW 3 145,020,691 (GRCm39) missense probably benign 0.03
R2216:Col24a1 UTSW 3 145,020,742 (GRCm39) missense probably benign 0.34
R2290:Col24a1 UTSW 3 145,218,950 (GRCm39) missense probably damaging 1.00
R3702:Col24a1 UTSW 3 145,043,621 (GRCm39) missense probably benign 0.01
R3772:Col24a1 UTSW 3 145,251,041 (GRCm39) missense probably damaging 1.00
R4086:Col24a1 UTSW 3 145,167,192 (GRCm39) missense probably damaging 1.00
R4236:Col24a1 UTSW 3 145,230,037 (GRCm39) nonsense probably null
R4433:Col24a1 UTSW 3 145,020,144 (GRCm39) missense possibly damaging 0.95
R4688:Col24a1 UTSW 3 145,020,144 (GRCm39) missense probably benign 0.00
R4972:Col24a1 UTSW 3 145,215,439 (GRCm39) missense probably benign 0.42
R5157:Col24a1 UTSW 3 145,051,712 (GRCm39) nonsense probably null
R5216:Col24a1 UTSW 3 145,021,071 (GRCm39) missense possibly damaging 0.85
R5274:Col24a1 UTSW 3 145,190,433 (GRCm39) missense probably benign 0.03
R5334:Col24a1 UTSW 3 145,167,280 (GRCm39) missense possibly damaging 0.91
R5416:Col24a1 UTSW 3 145,020,786 (GRCm39) nonsense probably null
R5473:Col24a1 UTSW 3 145,243,016 (GRCm39) missense probably benign 0.41
R5538:Col24a1 UTSW 3 144,998,882 (GRCm39) missense probably damaging 0.99
R5561:Col24a1 UTSW 3 145,004,588 (GRCm39) missense probably benign 0.26
R5648:Col24a1 UTSW 3 145,064,321 (GRCm39) missense probably benign 0.00
R5920:Col24a1 UTSW 3 145,133,985 (GRCm39) missense probably damaging 1.00
R6111:Col24a1 UTSW 3 145,019,815 (GRCm39) missense probably damaging 0.99
R6151:Col24a1 UTSW 3 145,019,815 (GRCm39) missense probably damaging 0.99
R6701:Col24a1 UTSW 3 145,020,141 (GRCm39) missense probably benign 0.00
R6728:Col24a1 UTSW 3 145,020,957 (GRCm39) missense probably benign
R6734:Col24a1 UTSW 3 145,214,429 (GRCm39) missense probably benign 0.06
R6861:Col24a1 UTSW 3 145,166,589 (GRCm39) missense probably damaging 1.00
R6982:Col24a1 UTSW 3 145,020,807 (GRCm39) nonsense probably null
R7001:Col24a1 UTSW 3 145,004,627 (GRCm39) missense probably benign 0.28
R7148:Col24a1 UTSW 3 145,021,060 (GRCm39) missense probably damaging 1.00
R7293:Col24a1 UTSW 3 145,192,059 (GRCm39) nonsense probably null
R7315:Col24a1 UTSW 3 145,137,625 (GRCm39) missense possibly damaging 0.82
R7358:Col24a1 UTSW 3 144,998,926 (GRCm39) critical splice donor site probably null
R7371:Col24a1 UTSW 3 145,049,459 (GRCm39) missense probably benign 0.06
R7383:Col24a1 UTSW 3 145,004,599 (GRCm39) missense probably benign
R7605:Col24a1 UTSW 3 145,244,442 (GRCm39) missense possibly damaging 0.67
R7650:Col24a1 UTSW 3 145,020,214 (GRCm39) missense probably benign 0.00
R7679:Col24a1 UTSW 3 145,105,110 (GRCm39) missense possibly damaging 0.81
R7701:Col24a1 UTSW 3 145,072,656 (GRCm39) splice site probably null
R7701:Col24a1 UTSW 3 145,020,772 (GRCm39) missense probably benign
R7805:Col24a1 UTSW 3 145,019,901 (GRCm39) missense probably benign 0.02
R7913:Col24a1 UTSW 3 145,137,621 (GRCm39) nonsense probably null
R7921:Col24a1 UTSW 3 145,179,993 (GRCm39) missense probably damaging 1.00
R8056:Col24a1 UTSW 3 145,019,925 (GRCm39) missense possibly damaging 0.73
R8240:Col24a1 UTSW 3 145,213,457 (GRCm39) missense probably benign 0.31
R8294:Col24a1 UTSW 3 145,186,844 (GRCm39) missense probably null 1.00
R8305:Col24a1 UTSW 3 145,179,937 (GRCm39) missense probably benign 0.00
R8430:Col24a1 UTSW 3 145,021,060 (GRCm39) missense probably damaging 1.00
R8708:Col24a1 UTSW 3 145,251,020 (GRCm39) missense probably damaging 0.99
R8880:Col24a1 UTSW 3 145,019,798 (GRCm39) missense probably null
R9056:Col24a1 UTSW 3 145,021,009 (GRCm39) missense probably damaging 0.96
R9461:Col24a1 UTSW 3 145,186,879 (GRCm39) nonsense probably null
R9612:Col24a1 UTSW 3 145,250,960 (GRCm39) missense probably benign 0.32
R9777:Col24a1 UTSW 3 145,021,103 (GRCm39) nonsense probably null
Z1176:Col24a1 UTSW 3 145,048,259 (GRCm39) missense probably damaging 1.00
Z1177:Col24a1 UTSW 3 145,048,260 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACAATCATGCCTCTCTCACTAGCTTTT -3'
(R):5'- TGTCTGCTTTCCTCCGACATGAACT -3'

Sequencing Primer
(F):5'- GTATGAATGCATAACAGTAAGGTCC -3'
(R):5'- GCTTTCCTCCGACATGAACTATTAG -3'
Posted On 2013-07-11