Incidental Mutation 'R7543:Pop1'
ID 584038
Institutional Source Beutler Lab
Gene Symbol Pop1
Ensembl Gene ENSMUSG00000022325
Gene Name processing of precursor 1, ribonuclease P/MRP family, (S. cerevisiae)
Synonyms 4932434G09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock # R7543 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 34495304-34530648 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 34530447 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 1027 (L1027Q)
Ref Sequence ENSEMBL: ENSMUSP00000052654 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052290] [ENSMUST00000079028]
AlphaFold Q8K205
Predicted Effect probably damaging
Transcript: ENSMUST00000052290
AA Change: L1027Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052654
Gene: ENSMUSG00000022325
AA Change: L1027Q

DomainStartEndE-ValueType
Pfam:POP1 107 190 6.2e-21 PFAM
Pfam:POP1 179 257 2.5e-23 PFAM
low complexity region 382 387 N/A INTRINSIC
Pfam:POPLD 647 738 1.4e-30 PFAM
low complexity region 931 940 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000079028
AA Change: L997Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078037
Gene: ENSMUSG00000022325
AA Change: L997Q

DomainStartEndE-ValueType
Pfam:POP1 107 258 1e-46 PFAM
low complexity region 382 387 N/A INTRINSIC
Pfam:POPLD 617 708 1.2e-34 PFAM
low complexity region 901 910 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the protein subunit of two different small nucleolar ribonucleoprotein complexes: the endoribonuclease for mitochondrial RNA processing complex and the ribonuclease P complex. The encoded protein is a ribonuclease that localizes to the nucleus and functions in pre-RNA processing. This protein is also an autoantigen in patients suffering from connective tissue diseases. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,225,392 I21T unknown Het
Aacs T A 5: 125,482,856 S54T probably damaging Het
Acsl5 G A 19: 55,278,183 V59I Het
Acss2 A T 2: 155,549,835 I203F probably damaging Het
Add2 A G 6: 86,106,225 N435S probably damaging Het
Afap1l1 T C 18: 61,756,901 D88G probably benign Het
Ank3 C T 10: 69,951,016 T970M possibly damaging Het
Ap3b2 A T 7: 81,466,146 probably null Het
Apc2 A G 10: 80,314,886 K1925E possibly damaging Het
Aspscr1 A G 11: 120,709,423 N130D unknown Het
B3glct A G 5: 149,754,139 D411G probably damaging Het
Bard1 T C 1: 71,075,430 K131E probably damaging Het
Bche T C 3: 73,701,733 D120G probably damaging Het
Brms1l A T 12: 55,868,212 D302V probably damaging Het
Ccdc191 T A 16: 43,898,209 Y56* probably null Het
Cela3a T A 4: 137,402,572 H246L probably damaging Het
Col11a2 A T 17: 34,050,456 D440V unknown Het
Dag1 C T 9: 108,218,081 V71I probably benign Het
Ddx23 A G 15: 98,658,258 S60P unknown Het
Dync1h1 G T 12: 110,614,107 R134L probably benign Het
Dync1i1 T C 6: 5,784,464 S103P possibly damaging Het
Erap1 T A 13: 74,674,634 D755E probably damaging Het
Exosc8 T C 3: 54,729,248 T221A probably benign Het
Fbxo4 T C 15: 3,977,903 D93G probably damaging Het
Fzd5 A G 1: 64,735,840 V254A probably damaging Het
Gbp3 T C 3: 142,566,580 V281A probably damaging Het
Gcc2 T A 10: 58,271,264 I774K probably benign Het
Gm20767 A C 13: 120,154,754 E43A probably damaging Het
Gm996 C A 2: 25,577,398 A834S possibly damaging Het
Gpr132 A C 12: 112,852,202 C335G probably benign Het
Gpr162 G T 6: 124,861,392 Y98* probably null Het
H2-T24 T C 17: 36,014,851 T283A possibly damaging Het
Hoxc6 A G 15: 103,009,754 Y50C probably damaging Het
Il4i1 A G 7: 44,836,775 N53S possibly damaging Het
Iqcf3 T C 9: 106,554,226 K60R possibly damaging Het
Kif24 A T 4: 41,413,993 Y316* probably null Het
Krt18 A G 15: 102,031,461 K365E probably damaging Het
Lrguk T A 6: 34,048,935 L222* probably null Het
Mbd1 T G 18: 74,274,449 V210G probably damaging Het
Ms4a6b A G 19: 11,521,791 I90V not run Het
Muc16 A G 9: 18,644,732 S3422P unknown Het
Mynn G A 3: 30,607,039 W90* probably null Het
Olfr467 T A 7: 107,815,101 N172K probably damaging Het
Pdpr T A 8: 111,132,888 H687Q probably damaging Het
Pkd1 A G 17: 24,595,253 E4199G probably damaging Het
Plekhg5 A G 4: 152,108,034 E517G probably damaging Het
Plxna1 T C 6: 89,322,855 D1644G probably damaging Het
Pon1 C T 6: 5,168,400 V336M possibly damaging Het
Pramel1 T C 4: 143,398,423 S306P probably damaging Het
Prpsap2 A T 11: 61,744,971 F168I possibly damaging Het
Rabgap1 T A 2: 37,469,432 D2E probably damaging Het
Rgmb A T 17: 15,807,515 L314Q probably damaging Het
Ryr2 C T 13: 11,638,431 probably null Het
Samd4b A T 7: 28,414,286 S85T probably benign Het
Sfrp5 T C 19: 42,198,863 D256G possibly damaging Het
Slc25a23 A G 17: 57,058,106 probably null Het
Sox5 A G 6: 143,841,179 I589T probably damaging Het
Sybu T A 15: 44,683,452 probably null Het
Syne2 A G 12: 75,906,842 E515G possibly damaging Het
Tbc1d17 G A 7: 44,846,079 A107V probably benign Het
Tex50 G T 1: 161,157,247 T141K possibly damaging Het
Tmc7 A G 7: 118,545,756 L527P probably benign Het
Tns4 T A 11: 99,072,253 D547V probably benign Het
Topors A G 4: 40,268,312 S65P probably damaging Het
Trdc T A 14: 54,144,235 S126T Het
Ttc27 A T 17: 74,717,750 probably benign Het
Wdfy3 A C 5: 101,936,059 I787S probably benign Het
Zc3h11a T C 1: 133,627,030 D404G possibly damaging Het
Zfp799 A G 17: 32,820,560 I244T probably benign Het
Zfp93 A G 7: 24,275,108 T173A probably benign Het
Zfp953 T A 13: 67,347,889 L29F probably damaging Het
Other mutations in Pop1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Pop1 APN 15 34508729 missense probably benign 0.00
IGL02192:Pop1 APN 15 34529071 missense probably benign 0.08
IGL02680:Pop1 APN 15 34502473 missense probably damaging 0.99
IGL02958:Pop1 APN 15 34530363 missense probably damaging 0.99
H8562:Pop1 UTSW 15 34530212 missense probably benign 0.00
PIT4802001:Pop1 UTSW 15 34529083 missense probably benign 0.00
R0244:Pop1 UTSW 15 34515891 nonsense probably null
R0281:Pop1 UTSW 15 34529858 splice site probably null
R0453:Pop1 UTSW 15 34526206 missense possibly damaging 0.82
R0579:Pop1 UTSW 15 34509969 missense possibly damaging 0.68
R1054:Pop1 UTSW 15 34509809 missense probably benign 0.30
R1501:Pop1 UTSW 15 34510357 missense probably benign 0.01
R1614:Pop1 UTSW 15 34530210 missense possibly damaging 0.46
R1994:Pop1 UTSW 15 34530471 missense probably damaging 1.00
R2084:Pop1 UTSW 15 34508598 splice site probably benign
R4020:Pop1 UTSW 15 34508780 missense probably benign 0.01
R4550:Pop1 UTSW 15 34528936 missense probably damaging 1.00
R4579:Pop1 UTSW 15 34515824 intron probably benign
R5672:Pop1 UTSW 15 34530179 missense possibly damaging 0.63
R6139:Pop1 UTSW 15 34529058 missense probably benign 0.26
R6161:Pop1 UTSW 15 34526310 missense probably damaging 1.00
R6821:Pop1 UTSW 15 34508639 missense possibly damaging 0.86
R7053:Pop1 UTSW 15 34530275 missense probably benign 0.01
R7195:Pop1 UTSW 15 34510379 missense probably damaging 0.97
R7571:Pop1 UTSW 15 34528947 missense probably null 1.00
R7587:Pop1 UTSW 15 34502413 missense probably damaging 0.97
R8401:Pop1 UTSW 15 34508609 missense probably damaging 1.00
R8406:Pop1 UTSW 15 34529170 missense probably benign
R8707:Pop1 UTSW 15 34529203 missense probably benign 0.02
R9044:Pop1 UTSW 15 34530408 missense possibly damaging 0.94
R9066:Pop1 UTSW 15 34515914 missense possibly damaging 0.68
R9236:Pop1 UTSW 15 34499412 missense probably damaging 0.98
RF001:Pop1 UTSW 15 34502437 missense probably damaging 1.00
RF002:Pop1 UTSW 15 34502437 missense probably damaging 1.00
Z1088:Pop1 UTSW 15 34499319 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCGACCCATTTAAAAGCCTG -3'
(R):5'- TTCCACGCAGTTCCACAATATATC -3'

Sequencing Primer
(F):5'- CGACCCATTTAAAAGCCTGATTCTG -3'
(R):5'- CAGGACTTTCTGTGAGCT -3'
Posted On 2019-10-17