Incidental Mutation 'R7543:Col11a2'
ID584047
Institutional Source Beutler Lab
Gene Symbol Col11a2
Ensembl Gene ENSMUSG00000024330
Gene Namecollagen, type XI, alpha 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.889) question?
Stock #R7543 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location34039437-34066685 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 34050456 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 440 (D440V)
Ref Sequence ENSEMBL: ENSMUSP00000122082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087497] [ENSMUST00000114252] [ENSMUST00000114255] [ENSMUST00000131134] [ENSMUST00000143354]
Predicted Effect probably damaging
Transcript: ENSMUST00000087497
AA Change: D354V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084772
Gene: ENSMUSG00000024330
AA Change: D354V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
TSPN 31 214 4.25e-72 SMART
LamG 82 213 1.08e-9 SMART
Pfam:Collagen 306 364 2.2e-9 PFAM
Pfam:Collagen 399 460 1e-10 PFAM
Pfam:Collagen 437 520 1.2e-7 PFAM
Pfam:Collagen 479 553 5.7e-9 PFAM
Pfam:Collagen 506 579 1.6e-8 PFAM
internal_repeat_4 584 614 3.98e-5 PROSPERO
internal_repeat_2 584 669 5.49e-20 PROSPERO
internal_repeat_1 587 740 2.58e-22 PROSPERO
Pfam:Collagen 743 814 1.5e-8 PFAM
Pfam:Collagen 767 839 4.8e-7 PFAM
low complexity region 854 872 N/A INTRINSIC
Pfam:Collagen 881 946 4.5e-8 PFAM
Pfam:Collagen 905 976 2e-7 PFAM
Pfam:Collagen 933 1002 2.7e-8 PFAM
low complexity region 1013 1047 N/A INTRINSIC
low complexity region 1064 1112 N/A INTRINSIC
low complexity region 1121 1199 N/A INTRINSIC
low complexity region 1216 1232 N/A INTRINSIC
low complexity region 1289 1320 N/A INTRINSIC
Pfam:Collagen 1358 1417 1.7e-8 PFAM
COLFI 1454 1649 4.42e-117 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114252
AA Change: D359V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109890
Gene: ENSMUSG00000024330
AA Change: D359V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
TSPN 31 214 4.25e-72 SMART
LamG 82 213 1.08e-9 SMART
Pfam:Collagen 311 369 2.3e-9 PFAM
Pfam:Collagen 404 465 1.1e-10 PFAM
Pfam:Collagen 442 525 1.3e-7 PFAM
Pfam:Collagen 484 558 6.4e-9 PFAM
Pfam:Collagen 511 584 1.7e-8 PFAM
internal_repeat_4 589 619 3.69e-5 PROSPERO
internal_repeat_2 589 674 4.46e-20 PROSPERO
internal_repeat_1 592 745 2.05e-22 PROSPERO
internal_repeat_3 636 752 7.84e-10 PROSPERO
Pfam:Collagen 772 844 5.5e-7 PFAM
Pfam:Collagen 800 869 1.9e-8 PFAM
Pfam:Collagen 886 951 5e-8 PFAM
Pfam:Collagen 910 981 2.2e-7 PFAM
Pfam:Collagen 934 1007 6.9e-7 PFAM
low complexity region 1018 1052 N/A INTRINSIC
low complexity region 1069 1117 N/A INTRINSIC
low complexity region 1126 1204 N/A INTRINSIC
low complexity region 1221 1237 N/A INTRINSIC
low complexity region 1294 1325 N/A INTRINSIC
Pfam:Collagen 1363 1422 1.9e-8 PFAM
COLFI 1459 1654 4.42e-117 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114255
AA Change: D393V

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000109893
Gene: ENSMUSG00000024330
AA Change: D393V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
TSPN 31 214 4.25e-72 SMART
LamG 82 213 1.08e-9 SMART
low complexity region 257 268 N/A INTRINSIC
low complexity region 295 307 N/A INTRINSIC
Pfam:Collagen 345 403 2.1e-9 PFAM
Pfam:Collagen 438 499 1.1e-10 PFAM
Pfam:Collagen 521 593 2.2e-8 PFAM
Pfam:Collagen 545 613 9.1e-10 PFAM
internal_repeat_4 623 653 2.83e-5 PROSPERO
internal_repeat_2 623 708 2.11e-20 PROSPERO
internal_repeat_1 626 779 9e-23 PROSPERO
internal_repeat_3 670 786 5.16e-10 PROSPERO
low complexity region 788 819 N/A INTRINSIC
low complexity region 830 857 N/A INTRINSIC
low complexity region 866 887 N/A INTRINSIC
low complexity region 893 911 N/A INTRINSIC
low complexity region 919 935 N/A INTRINSIC
Pfam:Collagen 973 1041 2.9e-8 PFAM
low complexity region 1052 1086 N/A INTRINSIC
low complexity region 1103 1151 N/A INTRINSIC
low complexity region 1160 1238 N/A INTRINSIC
low complexity region 1255 1271 N/A INTRINSIC
low complexity region 1328 1359 N/A INTRINSIC
Pfam:Collagen 1394 1456 1.5e-8 PFAM
COLFI 1493 1688 4.42e-117 SMART
Predicted Effect unknown
Transcript: ENSMUST00000131134
AA Change: D440V
SMART Domains Protein: ENSMUSP00000122082
Gene: ENSMUSG00000024330
AA Change: D440V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
TSPN 31 214 4.25e-72 SMART
LamG 82 213 1.08e-9 SMART
low complexity region 303 314 N/A INTRINSIC
low complexity region 342 354 N/A INTRINSIC
Pfam:Collagen 392 450 7.8e-10 PFAM
Pfam:Collagen 484 543 1.4e-10 PFAM
Pfam:Collagen 514 581 9.5e-11 PFAM
Pfam:Collagen 565 624 2.1e-11 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000143354
AA Change: D46V
SMART Domains Protein: ENSMUSP00000115026
Gene: ENSMUSG00000024330
AA Change: D46V

DomainStartEndE-ValueType
Pfam:Collagen 3 56 4.7e-9 PFAM
Pfam:Collagen 91 152 1.7e-9 PFAM
internal_repeat_1 158 301 3.7e-11 PROSPERO
internal_repeat_2 276 321 1.18e-9 PROSPERO
internal_repeat_4 291 306 1.06e-5 PROSPERO
internal_repeat_3 303 353 1.87e-6 PROSPERO
internal_repeat_2 315 360 1.18e-9 PROSPERO
internal_repeat_1 323 439 3.7e-11 PROSPERO
low complexity region 441 472 N/A INTRINSIC
low complexity region 483 510 N/A INTRINSIC
low complexity region 519 540 N/A INTRINSIC
low complexity region 546 564 N/A INTRINSIC
low complexity region 572 588 N/A INTRINSIC
Pfam:Collagen 603 673 6.6e-6 PFAM
Pfam:Collagen 627 694 5.4e-7 PFAM
Pfam:Collagen 660 734 3.2e-7 PFAM
Pfam:Collagen 711 770 1.1e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: This gene encodes the alpha-2 subunit of type XI collagen, one of the low abundance fibrillar collagens found in cartilage. The encoded protein, in association with other collagen subunits, forms a heterotrimeric type XI procollagen that may undergo proteolytic processing similar to the alpha-1 subunit. Mice lacking the encoded protein exhibit a mild phenotype similar to nonocular Stickler syndrome, otospondylomegaepiphyseal dysplasia (OSMED) as well as a nonsyndromic form of deafness called DFNA13. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous mutant animals exhibit reduced body size, short snout, a slightly bulged forehead, deafness, and disorganization of chondrocytes in the growth plate of long bones. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,225,392 I21T unknown Het
Aacs T A 5: 125,482,856 S54T probably damaging Het
Acsl5 G A 19: 55,278,183 V59I Het
Acss2 A T 2: 155,549,835 I203F probably damaging Het
Add2 A G 6: 86,106,225 N435S probably damaging Het
Afap1l1 T C 18: 61,756,901 D88G probably benign Het
Ank3 C T 10: 69,951,016 T970M possibly damaging Het
Ap3b2 A T 7: 81,466,146 probably null Het
Apc2 A G 10: 80,314,886 K1925E possibly damaging Het
Aspscr1 A G 11: 120,709,423 N130D unknown Het
B3glct A G 5: 149,754,139 D411G probably damaging Het
Bard1 T C 1: 71,075,430 K131E probably damaging Het
Bche T C 3: 73,701,733 D120G probably damaging Het
Brms1l A T 12: 55,868,212 D302V probably damaging Het
Ccdc191 T A 16: 43,898,209 Y56* probably null Het
Cela3a T A 4: 137,402,572 H246L probably damaging Het
Dag1 C T 9: 108,218,081 V71I probably benign Het
Ddx23 A G 15: 98,658,258 S60P unknown Het
Dync1h1 G T 12: 110,614,107 R134L probably benign Het
Dync1i1 T C 6: 5,784,464 S103P possibly damaging Het
Erap1 T A 13: 74,674,634 D755E probably damaging Het
Exosc8 T C 3: 54,729,248 T221A probably benign Het
Fbxo4 T C 15: 3,977,903 D93G probably damaging Het
Fzd5 A G 1: 64,735,840 V254A probably damaging Het
Gbp3 T C 3: 142,566,580 V281A probably damaging Het
Gcc2 T A 10: 58,271,264 I774K probably benign Het
Gm20767 A C 13: 120,154,754 E43A probably damaging Het
Gm996 C A 2: 25,577,398 A834S possibly damaging Het
Gpr132 A C 12: 112,852,202 C335G probably benign Het
Gpr162 G T 6: 124,861,392 Y98* probably null Het
H2-T24 T C 17: 36,014,851 T283A possibly damaging Het
Hoxc6 A G 15: 103,009,754 Y50C probably damaging Het
Il4i1 A G 7: 44,836,775 N53S possibly damaging Het
Iqcf3 T C 9: 106,554,226 K60R possibly damaging Het
Kif24 A T 4: 41,413,993 Y316* probably null Het
Krt18 A G 15: 102,031,461 K365E probably damaging Het
Lrguk T A 6: 34,048,935 L222* probably null Het
Mbd1 T G 18: 74,274,449 V210G probably damaging Het
Ms4a6b A G 19: 11,521,791 I90V not run Het
Muc16 A G 9: 18,644,732 S3422P unknown Het
Mynn G A 3: 30,607,039 W90* probably null Het
Olfr467 T A 7: 107,815,101 N172K probably damaging Het
Pdpr T A 8: 111,132,888 H687Q probably damaging Het
Pkd1 A G 17: 24,595,253 E4199G probably damaging Het
Plekhg5 A G 4: 152,108,034 E517G probably damaging Het
Plxna1 T C 6: 89,322,855 D1644G probably damaging Het
Pon1 C T 6: 5,168,400 V336M possibly damaging Het
Pop1 T A 15: 34,530,447 L1027Q probably damaging Het
Pramel1 T C 4: 143,398,423 S306P probably damaging Het
Prpsap2 A T 11: 61,744,971 F168I possibly damaging Het
Rabgap1 T A 2: 37,469,432 D2E probably damaging Het
Rgmb A T 17: 15,807,515 L314Q probably damaging Het
Ryr2 C T 13: 11,638,431 probably null Het
Samd4b A T 7: 28,414,286 S85T probably benign Het
Sfrp5 T C 19: 42,198,863 D256G possibly damaging Het
Slc25a23 A G 17: 57,058,106 probably null Het
Sox5 A G 6: 143,841,179 I589T probably damaging Het
Sybu T A 15: 44,683,452 probably null Het
Syne2 A G 12: 75,906,842 E515G possibly damaging Het
Tbc1d17 G A 7: 44,846,079 A107V probably benign Het
Tex50 G T 1: 161,157,247 T141K possibly damaging Het
Tmc7 A G 7: 118,545,756 L527P probably benign Het
Tns4 T A 11: 99,072,253 D547V probably benign Het
Topors A G 4: 40,268,312 S65P probably damaging Het
Trdc T A 14: 54,144,235 S126T Het
Ttc27 A T 17: 74,717,750 probably benign Het
Wdfy3 A C 5: 101,936,059 I787S probably benign Het
Zc3h11a T C 1: 133,627,030 D404G possibly damaging Het
Zfp799 A G 17: 32,820,560 I244T probably benign Het
Zfp93 A G 7: 24,275,108 T173A probably benign Het
Zfp953 T A 13: 67,347,889 L29F probably damaging Het
Other mutations in Col11a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01723:Col11a2 APN 17 34061280 unclassified probably benign
IGL01839:Col11a2 APN 17 34064082 unclassified probably benign
IGL02429:Col11a2 APN 17 34042292 missense probably damaging 1.00
IGL02491:Col11a2 APN 17 34064207 unclassified probably benign
PIT4531001:Col11a2 UTSW 17 34046438 critical splice acceptor site probably null
R0001:Col11a2 UTSW 17 34061612 missense probably benign 0.00
R0005:Col11a2 UTSW 17 34062879 unclassified probably benign
R0099:Col11a2 UTSW 17 34049674 missense probably damaging 0.99
R0106:Col11a2 UTSW 17 34057275 missense probably damaging 0.99
R0243:Col11a2 UTSW 17 34062546 unclassified probably benign
R0254:Col11a2 UTSW 17 34064803 unclassified probably benign
R0352:Col11a2 UTSW 17 34042527 missense probably benign 0.43
R0362:Col11a2 UTSW 17 34062446 splice site probably null
R0491:Col11a2 UTSW 17 34042212 missense probably null 0.00
R0531:Col11a2 UTSW 17 34058377 splice site probably benign
R0538:Col11a2 UTSW 17 34051328 splice site probably benign
R0646:Col11a2 UTSW 17 34059348 critical splice donor site probably null
R0676:Col11a2 UTSW 17 34057275 missense probably damaging 0.99
R0919:Col11a2 UTSW 17 34059150 missense possibly damaging 0.93
R1522:Col11a2 UTSW 17 34055254 missense probably damaging 1.00
R1767:Col11a2 UTSW 17 34063895 unclassified probably benign
R1872:Col11a2 UTSW 17 34062555 unclassified probably benign
R1941:Col11a2 UTSW 17 34044951 missense probably benign 0.01
R1945:Col11a2 UTSW 17 34059168 missense probably damaging 1.00
R2101:Col11a2 UTSW 17 34052169 missense probably damaging 1.00
R2161:Col11a2 UTSW 17 34064797 unclassified probably benign
R2258:Col11a2 UTSW 17 34039677 missense probably benign
R2259:Col11a2 UTSW 17 34039677 missense probably benign
R2260:Col11a2 UTSW 17 34039677 missense probably benign
R2761:Col11a2 UTSW 17 34051026 missense probably damaging 1.00
R3114:Col11a2 UTSW 17 34046468 missense possibly damaging 0.69
R3824:Col11a2 UTSW 17 34054180 missense probably damaging 1.00
R3938:Col11a2 UTSW 17 34039625 unclassified probably benign
R4039:Col11a2 UTSW 17 34045774 missense probably benign 0.00
R4675:Col11a2 UTSW 17 34064293 critical splice donor site probably null
R4810:Col11a2 UTSW 17 34057112 missense probably damaging 0.99
R4824:Col11a2 UTSW 17 34050963 missense probably damaging 1.00
R4944:Col11a2 UTSW 17 34042190 missense possibly damaging 0.47
R5112:Col11a2 UTSW 17 34064088 unclassified probably benign
R5355:Col11a2 UTSW 17 34051801 missense probably benign 0.07
R5384:Col11a2 UTSW 17 34059174 critical splice donor site probably null
R5534:Col11a2 UTSW 17 34051024 missense probably damaging 0.99
R5860:Col11a2 UTSW 17 34064185 unclassified probably benign
R6252:Col11a2 UTSW 17 34042212 missense probably null 0.00
R6327:Col11a2 UTSW 17 34043317 missense probably benign 0.32
R6828:Col11a2 UTSW 17 34053633 splice site probably null
R6860:Col11a2 UTSW 17 34053598 missense probably damaging 1.00
R6873:Col11a2 UTSW 17 34065019 missense unknown
R6992:Col11a2 UTSW 17 34047144 missense probably benign 0.01
R7292:Col11a2 UTSW 17 34051508 missense unknown
X0017:Col11a2 UTSW 17 34059985 critical splice donor site probably null
X0064:Col11a2 UTSW 17 34042247 missense possibly damaging 0.88
Z1176:Col11a2 UTSW 17 34056402 missense unknown
Z1177:Col11a2 UTSW 17 34051666 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- TAAAGTGTGGGAGCCCTCTC -3'
(R):5'- ATGGTCCATGCACTGAGACTTC -3'

Sequencing Primer
(F):5'- TGGAGAGAACATGATCTAGCATCTCC -3'
(R):5'- CTGAGACTTCAGGTGTGCAC -3'
Posted On2019-10-17