Incidental Mutation 'R7544:Cyp4a14'
ID584069
Institutional Source Beutler Lab
Gene Symbol Cyp4a14
Ensembl Gene ENSMUSG00000028715
Gene Namecytochrome P450, family 4, subfamily a, polypeptide 14
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R7544 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location115486200-115496142 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 115491086 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 398 (D398V)
Ref Sequence ENSEMBL: ENSMUSP00000030487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030487]
Predicted Effect probably damaging
Transcript: ENSMUST00000030487
AA Change: D398V

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000030487
Gene: ENSMUSG00000028715
AA Change: D398V

DomainStartEndE-ValueType
transmembrane domain 15 32 N/A INTRINSIC
Pfam:p450 51 503 5.4e-129 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Male mice homozygous for disruption of this gene display high blood pressure. Blood pressure is elevated in females as well to levels comparable to normotensive males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930539E08Rik G A 17: 28,905,324 R335W probably damaging Het
4933427D14Rik C T 11: 72,198,939 V40I probably damaging Het
Abcb11 T C 2: 69,265,486 K837E probably benign Het
Arhgef10 T C 8: 14,979,854 S919P probably benign Het
Atxn2 T C 5: 121,781,368 S530P probably damaging Het
Bicc1 T C 10: 70,956,374 E268G possibly damaging Het
Capn7 T G 14: 31,340,050 L40V probably damaging Het
Cd28 A T 1: 60,769,700 N191I probably damaging Het
Cfap69 G A 5: 5,595,936 T588M not run Het
Csmd1 T C 8: 16,092,296 E1531G probably damaging Het
Dchs2 T C 3: 83,355,127 S2901P probably damaging Het
Ddx11 G A 17: 66,126,285 G37S probably damaging Het
Diaph1 A T 18: 37,893,269 probably null Het
Ech1 T C 7: 28,825,967 V49A probably benign Het
Elovl4 T C 9: 83,783,218 Y196C probably damaging Het
Ern2 G A 7: 122,173,199 L679F probably benign Het
Fbf1 A T 11: 116,165,833 M17K probably benign Het
Flvcr1 C A 1: 191,025,946 G50W probably damaging Het
Fryl A G 5: 73,081,039 S1455P probably benign Het
Fzd9 A G 5: 135,249,862 Y390H probably damaging Het
Gm10436 T A 12: 88,176,080 Y451F probably benign Het
Gm12800 T C 4: 101,911,402 S317P possibly damaging Het
Gm884 T C 11: 103,615,448 E1898G probably benign Het
Gnai3 C T 3: 108,118,386 V126M Het
Gpc5 T C 14: 115,428,173 F470L probably damaging Het
Grin1 T C 2: 25,305,074 N332S probably benign Het
Gtf3c5 T A 2: 28,579,542 I117F possibly damaging Het
Hydin A T 8: 110,589,525 S4350C probably benign Het
Kcnh4 G T 11: 100,757,080 H152Q probably benign Het
Kcnk12 A T 17: 87,746,065 S390T possibly damaging Het
Klra9 T G 6: 130,191,220 T28P probably benign Het
Lef1 T A 3: 131,194,765 I327N probably damaging Het
Lin54 A G 5: 100,485,270 V185A possibly damaging Het
Lrrc4b A T 7: 44,462,551 I616F probably damaging Het
Mad2l1bp A G 17: 46,152,844 Y85H possibly damaging Het
Mars T C 10: 127,311,610 E7G probably benign Het
Mpnd G A 17: 56,011,666 R225H probably benign Het
Muc4 T A 16: 32,736,198 M1K probably null Het
Nckap5 A G 1: 126,026,211 L868S possibly damaging Het
Ndst1 G A 18: 60,697,184 T618M probably damaging Het
Npas1 A T 7: 16,460,974 probably null Het
Nr2f2 A T 7: 70,354,751 V384D probably damaging Het
Olfr1208 T A 2: 88,897,361 I79F probably damaging Het
Olfr378 A G 11: 73,425,770 L71P probably damaging Het
Olfr516 A G 7: 108,845,321 S230P probably benign Het
Paip1 T A 13: 119,445,801 F188I probably damaging Het
Pcdha4 A T 18: 36,953,723 I320L probably benign Het
Peg10 TCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATC T 6: 4,756,427 probably null Het
Pgpep1 C T 8: 70,650,518 G110R unknown Het
Pidd1 T A 7: 141,440,339 H558L possibly damaging Het
Ppp1r1a C T 15: 103,531,349 probably null Het
Prkcg A G 7: 3,310,565 D96G probably benign Het
Prpf40b A G 15: 99,306,018 N154S probably benign Het
Psg17 A G 7: 18,819,972 Y118H probably benign Het
Ptpn12 A G 5: 21,009,511 I209T probably damaging Het
Reln T A 5: 21,976,278 K1835* probably null Het
Sf3b3 T C 8: 110,838,283 M298V probably benign Het
Slc5a3 T A 16: 92,077,794 N246K probably benign Het
Slmap T A 14: 26,429,846 E522D probably damaging Het
Slmap C T 14: 26,429,848 E522K probably damaging Het
Tcp10c T A 17: 13,360,998 L230Q probably damaging Het
Tdo2 A G 3: 81,971,635 probably null Het
Tet3 A T 6: 83,404,641 W182R probably damaging Het
Tmem151a T A 19: 5,071,867 M35L unknown Het
Tom1l2 TTGATGATG TTGATG 11: 60,280,214 probably benign Het
Trak2 A T 1: 58,921,068 probably null Het
Trappc11 T A 8: 47,522,414 E256D possibly damaging Het
Trim62 C T 4: 128,902,553 T281I probably benign Het
Trip13 T C 13: 73,932,902 E115G probably benign Het
Trp63 A G 16: 25,802,087 T10A probably benign Het
Urah A T 7: 140,835,652 H11L probably damaging Het
Usp39 G A 6: 72,342,908 T109I probably damaging Het
Wfikkn2 T C 11: 94,237,912 T468A probably benign Het
Zfhx4 T G 3: 5,412,815 S3497A probably damaging Het
Zfp85 C T 13: 67,749,065 R296H probably benign Het
Other mutations in Cyp4a14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Cyp4a14 APN 4 115489952 splice site probably benign
IGL01539:Cyp4a14 APN 4 115487177 missense possibly damaging 0.71
IGL01802:Cyp4a14 APN 4 115494937 nonsense probably null
IGL02309:Cyp4a14 APN 4 115491632 missense probably damaging 0.99
IGL02330:Cyp4a14 APN 4 115495027 splice site probably benign
IGL03302:Cyp4a14 APN 4 115491378 missense probably benign 0.00
R1037:Cyp4a14 UTSW 4 115489996 missense probably damaging 1.00
R1236:Cyp4a14 UTSW 4 115492170 missense probably benign 0.01
R2132:Cyp4a14 UTSW 4 115491391 missense probably damaging 1.00
R2133:Cyp4a14 UTSW 4 115491391 missense probably damaging 1.00
R2870:Cyp4a14 UTSW 4 115487301 missense probably damaging 1.00
R2870:Cyp4a14 UTSW 4 115487301 missense probably damaging 1.00
R2871:Cyp4a14 UTSW 4 115487301 missense probably damaging 1.00
R2871:Cyp4a14 UTSW 4 115487301 missense probably damaging 1.00
R2872:Cyp4a14 UTSW 4 115487301 missense probably damaging 1.00
R2872:Cyp4a14 UTSW 4 115487301 missense probably damaging 1.00
R2873:Cyp4a14 UTSW 4 115487301 missense probably damaging 1.00
R4015:Cyp4a14 UTSW 4 115491134 missense probably damaging 1.00
R4925:Cyp4a14 UTSW 4 115495936 missense possibly damaging 0.68
R5104:Cyp4a14 UTSW 4 115495929 missense probably damaging 1.00
R5135:Cyp4a14 UTSW 4 115489960 critical splice donor site probably null
R5150:Cyp4a14 UTSW 4 115493609 missense probably damaging 1.00
R5930:Cyp4a14 UTSW 4 115491410 missense probably damaging 1.00
R5997:Cyp4a14 UTSW 4 115496100 nonsense probably null
R6269:Cyp4a14 UTSW 4 115491131 missense possibly damaging 0.87
R6354:Cyp4a14 UTSW 4 115487244 missense probably damaging 1.00
R6377:Cyp4a14 UTSW 4 115496083 missense probably benign 0.01
R6534:Cyp4a14 UTSW 4 115489959 splice site probably null
R6563:Cyp4a14 UTSW 4 115492086 missense probably benign 0.23
R6751:Cyp4a14 UTSW 4 115491194 missense probably damaging 0.99
R7039:Cyp4a14 UTSW 4 115491081 missense probably benign 0.23
R7125:Cyp4a14 UTSW 4 115491161 missense probably damaging 1.00
R7379:Cyp4a14 UTSW 4 115493710 splice site probably null
R7591:Cyp4a14 UTSW 4 115489960 critical splice donor site probably null
R7740:Cyp4a14 UTSW 4 115493609 missense probably damaging 1.00
R7741:Cyp4a14 UTSW 4 115489959 splice site probably null
R7753:Cyp4a14 UTSW 4 115493664 missense probably damaging 1.00
R7789:Cyp4a14 UTSW 4 115494910 missense probably benign 0.00
R8064:Cyp4a14 UTSW 4 115494958 missense probably benign
R8311:Cyp4a14 UTSW 4 115491078 missense probably damaging 1.00
R8458:Cyp4a14 UTSW 4 115495932 missense probably damaging 1.00
R8868:Cyp4a14 UTSW 4 115491356 missense probably damaging 1.00
Z1176:Cyp4a14 UTSW 4 115490017 missense probably benign 0.01
Z1177:Cyp4a14 UTSW 4 115491453 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- ACGTGACTGCAATTTCAAGTC -3'
(R):5'- ACCTCTGTCACATGGTAAGAACC -3'

Sequencing Primer
(F):5'- CCTCTGCTATATAGGCAGCTGAAG -3'
(R):5'- CACTTGTCTTTTTATAGGAGAGACC -3'
Posted On2019-10-17