Incidental Mutation 'R7544:Arhgef10'
ID584091
Institutional Source Beutler Lab
Gene Symbol Arhgef10
Ensembl Gene ENSMUSG00000071176
Gene NameRho guanine nucleotide exchange factor (GEF) 10
Synonyms6430549H08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7544 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location14911663-15001085 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 14979854 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 919 (S919P)
Ref Sequence ENSEMBL: ENSMUSP00000081225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084207] [ENSMUST00000110800] [ENSMUST00000163062]
Predicted Effect probably benign
Transcript: ENSMUST00000084207
AA Change: S919P

PolyPhen 2 Score 0.341 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000081225
Gene: ENSMUSG00000071176
AA Change: S919P

DomainStartEndE-ValueType
low complexity region 73 82 N/A INTRINSIC
low complexity region 155 165 N/A INTRINSIC
low complexity region 236 245 N/A INTRINSIC
low complexity region 247 265 N/A INTRINSIC
coiled coil region 308 335 N/A INTRINSIC
RhoGEF 401 583 9.79e-58 SMART
Blast:PH 617 829 6e-47 BLAST
low complexity region 1256 1272 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110800
AA Change: S880P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106424
Gene: ENSMUSG00000071176
AA Change: S880P

DomainStartEndE-ValueType
low complexity region 73 82 N/A INTRINSIC
low complexity region 155 165 N/A INTRINSIC
low complexity region 236 245 N/A INTRINSIC
low complexity region 247 265 N/A INTRINSIC
low complexity region 280 291 N/A INTRINSIC
RhoGEF 362 544 9.79e-58 SMART
Blast:PH 578 790 8e-47 BLAST
low complexity region 1217 1233 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163062
AA Change: S562P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000125526
Gene: ENSMUSG00000071176
AA Change: S562P

DomainStartEndE-ValueType
RhoGEF 73 255 9.79e-58 SMART
Blast:PH 289 501 2e-47 BLAST
low complexity region 899 915 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Rho guanine nucleotide exchange factor (GEF). Rho GEFs regulate the activity of small Rho GTPases by stimulating the exchange of guanine diphosphate (GDP) for guanine triphosphate (GTP) and may play a role in neural morphogenesis. Mutations in this gene are associated with slowed nerve conduction velocity (SNCV). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930539E08Rik G A 17: 28,905,324 R335W probably damaging Het
4933427D14Rik C T 11: 72,198,939 V40I probably damaging Het
Abcb11 T C 2: 69,265,486 K837E probably benign Het
Atxn2 T C 5: 121,781,368 S530P probably damaging Het
Bicc1 T C 10: 70,956,374 E268G possibly damaging Het
Capn7 T G 14: 31,340,050 L40V probably damaging Het
Cd28 A T 1: 60,769,700 N191I probably damaging Het
Cfap69 G A 5: 5,595,936 T588M not run Het
Csmd1 T C 8: 16,092,296 E1531G probably damaging Het
Cyp4a14 T A 4: 115,491,086 D398V probably damaging Het
Dchs2 T C 3: 83,355,127 S2901P probably damaging Het
Ddx11 G A 17: 66,126,285 G37S probably damaging Het
Diaph1 A T 18: 37,893,269 probably null Het
Ech1 T C 7: 28,825,967 V49A probably benign Het
Elovl4 T C 9: 83,783,218 Y196C probably damaging Het
Ern2 G A 7: 122,173,199 L679F probably benign Het
Fbf1 A T 11: 116,165,833 M17K probably benign Het
Flvcr1 C A 1: 191,025,946 G50W probably damaging Het
Fryl A G 5: 73,081,039 S1455P probably benign Het
Fzd9 A G 5: 135,249,862 Y390H probably damaging Het
Gm10436 T A 12: 88,176,080 Y451F probably benign Het
Gm12800 T C 4: 101,911,402 S317P possibly damaging Het
Gm884 T C 11: 103,615,448 E1898G probably benign Het
Gnai3 C T 3: 108,118,386 V126M Het
Gpc5 T C 14: 115,428,173 F470L probably damaging Het
Grin1 T C 2: 25,305,074 N332S probably benign Het
Gtf3c5 T A 2: 28,579,542 I117F possibly damaging Het
Hydin A T 8: 110,589,525 S4350C probably benign Het
Kcnh4 G T 11: 100,757,080 H152Q probably benign Het
Kcnk12 A T 17: 87,746,065 S390T possibly damaging Het
Klra9 T G 6: 130,191,220 T28P probably benign Het
Lef1 T A 3: 131,194,765 I327N probably damaging Het
Lin54 A G 5: 100,485,270 V185A possibly damaging Het
Lrrc4b A T 7: 44,462,551 I616F probably damaging Het
Mad2l1bp A G 17: 46,152,844 Y85H possibly damaging Het
Mars T C 10: 127,311,610 E7G probably benign Het
Mpnd G A 17: 56,011,666 R225H probably benign Het
Muc4 T A 16: 32,736,198 M1K probably null Het
Nckap5 A G 1: 126,026,211 L868S possibly damaging Het
Ndst1 G A 18: 60,697,184 T618M probably damaging Het
Npas1 A T 7: 16,460,974 probably null Het
Nr2f2 A T 7: 70,354,751 V384D probably damaging Het
Olfr1208 T A 2: 88,897,361 I79F probably damaging Het
Olfr378 A G 11: 73,425,770 L71P probably damaging Het
Olfr516 A G 7: 108,845,321 S230P probably benign Het
Paip1 T A 13: 119,445,801 F188I probably damaging Het
Pcdha4 A T 18: 36,953,723 I320L probably benign Het
Peg10 TCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATC T 6: 4,756,427 probably null Het
Pgpep1 C T 8: 70,650,518 G110R unknown Het
Pidd1 T A 7: 141,440,339 H558L possibly damaging Het
Ppp1r1a C T 15: 103,531,349 probably null Het
Prkcg A G 7: 3,310,565 D96G probably benign Het
Prpf40b A G 15: 99,306,018 N154S probably benign Het
Psg17 A G 7: 18,819,972 Y118H probably benign Het
Ptpn12 A G 5: 21,009,511 I209T probably damaging Het
Reln T A 5: 21,976,278 K1835* probably null Het
Sf3b3 T C 8: 110,838,283 M298V probably benign Het
Slc5a3 T A 16: 92,077,794 N246K probably benign Het
Slmap T A 14: 26,429,846 E522D probably damaging Het
Slmap C T 14: 26,429,848 E522K probably damaging Het
Tcp10c T A 17: 13,360,998 L230Q probably damaging Het
Tdo2 A G 3: 81,971,635 probably null Het
Tet3 A T 6: 83,404,641 W182R probably damaging Het
Tmem151a T A 19: 5,071,867 M35L unknown Het
Tom1l2 TTGATGATG TTGATG 11: 60,280,214 probably benign Het
Trak2 A T 1: 58,921,068 probably null Het
Trappc11 T A 8: 47,522,414 E256D possibly damaging Het
Trim62 C T 4: 128,902,553 T281I probably benign Het
Trip13 T C 13: 73,932,902 E115G probably benign Het
Trp63 A G 16: 25,802,087 T10A probably benign Het
Urah A T 7: 140,835,652 H11L probably damaging Het
Usp39 G A 6: 72,342,908 T109I probably damaging Het
Wfikkn2 T C 11: 94,237,912 T468A probably benign Het
Zfhx4 T G 3: 5,412,815 S3497A probably damaging Het
Zfp85 C T 13: 67,749,065 R296H probably benign Het
Other mutations in Arhgef10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Arhgef10 APN 8 14975006 missense probably damaging 1.00
IGL00823:Arhgef10 APN 8 14940378 unclassified probably benign
IGL01012:Arhgef10 APN 8 14979977 missense probably damaging 0.99
IGL01311:Arhgef10 APN 8 14991054 splice site probably null
IGL01596:Arhgef10 APN 8 14999468 nonsense probably null
IGL01888:Arhgef10 APN 8 14962577 nonsense probably null
IGL01938:Arhgef10 APN 8 14991062 missense probably benign 0.09
IGL02151:Arhgef10 APN 8 14928889 missense possibly damaging 0.77
IGL02274:Arhgef10 APN 8 14947205 missense probably damaging 0.99
IGL02369:Arhgef10 APN 8 14997551 missense probably damaging 1.00
IGL02411:Arhgef10 APN 8 14954819 missense probably benign 0.01
IGL02500:Arhgef10 APN 8 14961238 missense probably damaging 1.00
IGL02597:Arhgef10 APN 8 14930198 missense probably benign 0.27
IGL02602:Arhgef10 APN 8 14930198 missense probably benign 0.27
IGL02743:Arhgef10 APN 8 14930198 missense probably benign 0.27
IGL02744:Arhgef10 APN 8 14930198 missense probably benign 0.27
IGL03113:Arhgef10 APN 8 14954505 missense probably damaging 1.00
IGL03248:Arhgef10 APN 8 14928847 missense probably benign 0.00
P0028:Arhgef10 UTSW 8 14928925 missense possibly damaging 0.79
P4748:Arhgef10 UTSW 8 14928925 missense possibly damaging 0.79
R0049:Arhgef10 UTSW 8 14954446 missense probably damaging 1.00
R0197:Arhgef10 UTSW 8 14962636 missense probably damaging 1.00
R0479:Arhgef10 UTSW 8 14991070 missense probably damaging 0.98
R0701:Arhgef10 UTSW 8 14962636 missense probably damaging 1.00
R0966:Arhgef10 UTSW 8 14940343 missense probably benign 0.01
R1367:Arhgef10 UTSW 8 14940225 missense probably damaging 1.00
R1572:Arhgef10 UTSW 8 14991211 missense possibly damaging 0.53
R1631:Arhgef10 UTSW 8 14947157 missense probably damaging 0.98
R1766:Arhgef10 UTSW 8 14979836 missense probably damaging 1.00
R1920:Arhgef10 UTSW 8 14956987 splice site probably benign
R2051:Arhgef10 UTSW 8 14945320 missense probably null 1.00
R2088:Arhgef10 UTSW 8 14983898 missense possibly damaging 0.46
R2118:Arhgef10 UTSW 8 14934820 missense probably damaging 0.99
R2120:Arhgef10 UTSW 8 14934820 missense probably damaging 0.99
R2121:Arhgef10 UTSW 8 14934820 missense probably damaging 0.99
R2122:Arhgef10 UTSW 8 14934820 missense probably damaging 0.99
R2124:Arhgef10 UTSW 8 14934820 missense probably damaging 0.99
R2318:Arhgef10 UTSW 8 14928855 missense probably damaging 1.00
R2870:Arhgef10 UTSW 8 14975093 critical splice donor site probably null
R2870:Arhgef10 UTSW 8 14975666 missense probably benign 0.01
R2870:Arhgef10 UTSW 8 14975093 critical splice donor site probably null
R2870:Arhgef10 UTSW 8 14975666 missense probably benign 0.01
R2872:Arhgef10 UTSW 8 14975093 critical splice donor site probably null
R2872:Arhgef10 UTSW 8 14975666 missense probably benign 0.01
R2872:Arhgef10 UTSW 8 14975093 critical splice donor site probably null
R2872:Arhgef10 UTSW 8 14975666 missense probably benign 0.01
R2874:Arhgef10 UTSW 8 14975093 critical splice donor site probably null
R2874:Arhgef10 UTSW 8 14975666 missense probably benign 0.01
R3522:Arhgef10 UTSW 8 14954918 missense probably damaging 1.00
R4049:Arhgef10 UTSW 8 14979998 missense probably benign 0.05
R4324:Arhgef10 UTSW 8 14940335 missense possibly damaging 0.77
R4351:Arhgef10 UTSW 8 14991145 nonsense probably null
R4384:Arhgef10 UTSW 8 14930157 nonsense probably null
R4385:Arhgef10 UTSW 8 14930157 nonsense probably null
R4685:Arhgef10 UTSW 8 14956963 missense probably damaging 1.00
R5111:Arhgef10 UTSW 8 14932408 missense probably benign 0.00
R5169:Arhgef10 UTSW 8 14930051 missense possibly damaging 0.80
R5670:Arhgef10 UTSW 8 14954774 missense probably benign 0.01
R5945:Arhgef10 UTSW 8 14980028 critical splice donor site probably null
R6593:Arhgef10 UTSW 8 14962522 missense probably damaging 1.00
R6593:Arhgef10 UTSW 8 14962564 missense possibly damaging 0.82
R6734:Arhgef10 UTSW 8 14975053 missense probably damaging 1.00
R6859:Arhgef10 UTSW 8 14975005 missense probably damaging 1.00
R6890:Arhgef10 UTSW 8 14928786 missense probably benign 0.27
R7068:Arhgef10 UTSW 8 14958639 missense probably damaging 1.00
R7081:Arhgef10 UTSW 8 14997547 nonsense probably null
R7157:Arhgef10 UTSW 8 14930030 missense probably damaging 1.00
R7232:Arhgef10 UTSW 8 14940323 missense probably benign 0.10
R7514:Arhgef10 UTSW 8 14975956 missense probably benign 0.16
R7657:Arhgef10 UTSW 8 14979893 missense probably damaging 1.00
R7736:Arhgef10 UTSW 8 14980583 nonsense probably null
R7777:Arhgef10 UTSW 8 14945373 missense probably damaging 1.00
R8000:Arhgef10 UTSW 8 14930054 missense probably damaging 1.00
R8060:Arhgef10 UTSW 8 14954446 missense probably damaging 1.00
R8441:Arhgef10 UTSW 8 14991237 splice site probably benign
R8545:Arhgef10 UTSW 8 14928868 missense probably benign 0.00
R8545:Arhgef10 UTSW 8 14975931 missense possibly damaging 0.83
R8702:Arhgef10 UTSW 8 14942638 missense probably benign
R8846:Arhgef10 UTSW 8 14975956 missense probably benign 0.16
R8854:Arhgef10 UTSW 8 14979798 critical splice acceptor site probably null
X0024:Arhgef10 UTSW 8 14978486 missense probably benign 0.01
X0027:Arhgef10 UTSW 8 14997631 missense possibly damaging 0.92
Z1088:Arhgef10 UTSW 8 14964191 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACAATGGAAATCAGTACCGTCC -3'
(R):5'- GCACTGAGGACAATCCCTAG -3'

Sequencing Primer
(F):5'- AAATCAGTACCGTCCTGGGTCAG -3'
(R):5'- ACAATCCCTAGAACAGTGTGTG -3'
Posted On2019-10-17