Incidental Mutation 'R7544:Wfikkn2'
ID584103
Institutional Source Beutler Lab
Gene Symbol Wfikkn2
Ensembl Gene ENSMUSG00000044177
Gene NameWAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 2
Synonyms2610304F08Rik, Gasp1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7544 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location94235956-94246005 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 94237912 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 468 (T468A)
Ref Sequence ENSEMBL: ENSMUSP00000053238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061469]
Predicted Effect probably benign
Transcript: ENSMUST00000061469
AA Change: T468A

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000053238
Gene: ENSMUSG00000044177
AA Change: T468A

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
WAP 37 87 1.77e-3 SMART
low complexity region 91 102 N/A INTRINSIC
KAZAL 128 170 1.5e-2 SMART
low complexity region 179 192 N/A INTRINSIC
IGc2 217 289 1.3e-11 SMART
KU 321 374 2e-14 SMART
KU 379 432 2.79e-27 SMART
Pfam:NTR 451 556 2.1e-13 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The WFIKKN1 protein contains a WAP domain, follistatin domain, immunoglobulin domain, two tandem Kunitz domains, and an NTR domain. This gene encodes a WFIKKN1-related protein which has the same domain organization as the WFIKKN1 protein. The WAP-type, follistatin type, Kunitz-type, and NTR-type protease inhibitory domains may control the action of multiple types of proteases. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation show impaired muscle regeneration and a mild decrease in skeletal muscle weight in males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930539E08Rik G A 17: 28,905,324 R335W probably damaging Het
4933427D14Rik C T 11: 72,198,939 V40I probably damaging Het
Abcb11 T C 2: 69,265,486 K837E probably benign Het
Arhgef10 T C 8: 14,979,854 S919P probably benign Het
Atxn2 T C 5: 121,781,368 S530P probably damaging Het
Bicc1 T C 10: 70,956,374 E268G possibly damaging Het
Capn7 T G 14: 31,340,050 L40V probably damaging Het
Cd28 A T 1: 60,769,700 N191I probably damaging Het
Cfap69 G A 5: 5,595,936 T588M not run Het
Csmd1 T C 8: 16,092,296 E1531G probably damaging Het
Cyp4a14 T A 4: 115,491,086 D398V probably damaging Het
Dchs2 T C 3: 83,355,127 S2901P probably damaging Het
Ddx11 G A 17: 66,126,285 G37S probably damaging Het
Diaph1 A T 18: 37,893,269 probably null Het
Ech1 T C 7: 28,825,967 V49A probably benign Het
Elovl4 T C 9: 83,783,218 Y196C probably damaging Het
Ern2 G A 7: 122,173,199 L679F probably benign Het
Fbf1 A T 11: 116,165,833 M17K probably benign Het
Flvcr1 C A 1: 191,025,946 G50W probably damaging Het
Fryl A G 5: 73,081,039 S1455P probably benign Het
Fzd9 A G 5: 135,249,862 Y390H probably damaging Het
Gm10436 T A 12: 88,176,080 Y451F probably benign Het
Gm12800 T C 4: 101,911,402 S317P possibly damaging Het
Gm884 T C 11: 103,615,448 E1898G probably benign Het
Gnai3 C T 3: 108,118,386 V126M Het
Gpc5 T C 14: 115,428,173 F470L probably damaging Het
Grin1 T C 2: 25,305,074 N332S probably benign Het
Gtf3c5 T A 2: 28,579,542 I117F possibly damaging Het
Hydin A T 8: 110,589,525 S4350C probably benign Het
Kcnh4 G T 11: 100,757,080 H152Q probably benign Het
Kcnk12 A T 17: 87,746,065 S390T possibly damaging Het
Klra9 T G 6: 130,191,220 T28P probably benign Het
Lef1 T A 3: 131,194,765 I327N probably damaging Het
Lin54 A G 5: 100,485,270 V185A possibly damaging Het
Lrrc4b A T 7: 44,462,551 I616F probably damaging Het
Mad2l1bp A G 17: 46,152,844 Y85H possibly damaging Het
Mars T C 10: 127,311,610 E7G probably benign Het
Mpnd G A 17: 56,011,666 R225H probably benign Het
Muc4 T A 16: 32,736,198 M1K probably null Het
Nckap5 A G 1: 126,026,211 L868S possibly damaging Het
Ndst1 G A 18: 60,697,184 T618M probably damaging Het
Npas1 A T 7: 16,460,974 probably null Het
Nr2f2 A T 7: 70,354,751 V384D probably damaging Het
Olfr1208 T A 2: 88,897,361 I79F probably damaging Het
Olfr378 A G 11: 73,425,770 L71P probably damaging Het
Olfr516 A G 7: 108,845,321 S230P probably benign Het
Paip1 T A 13: 119,445,801 F188I probably damaging Het
Pcdha4 A T 18: 36,953,723 I320L probably benign Het
Peg10 TCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATC T 6: 4,756,427 probably null Het
Pgpep1 C T 8: 70,650,518 G110R unknown Het
Pidd1 T A 7: 141,440,339 H558L possibly damaging Het
Ppp1r1a C T 15: 103,531,349 probably null Het
Prkcg A G 7: 3,310,565 D96G probably benign Het
Prpf40b A G 15: 99,306,018 N154S probably benign Het
Psg17 A G 7: 18,819,972 Y118H probably benign Het
Ptpn12 A G 5: 21,009,511 I209T probably damaging Het
Reln T A 5: 21,976,278 K1835* probably null Het
Sf3b3 T C 8: 110,838,283 M298V probably benign Het
Slc5a3 T A 16: 92,077,794 N246K probably benign Het
Slmap T A 14: 26,429,846 E522D probably damaging Het
Slmap C T 14: 26,429,848 E522K probably damaging Het
Tcp10c T A 17: 13,360,998 L230Q probably damaging Het
Tdo2 A G 3: 81,971,635 probably null Het
Tet3 A T 6: 83,404,641 W182R probably damaging Het
Tmem151a T A 19: 5,071,867 M35L unknown Het
Tom1l2 TTGATGATG TTGATG 11: 60,280,214 probably benign Het
Trak2 A T 1: 58,921,068 probably null Het
Trappc11 T A 8: 47,522,414 E256D possibly damaging Het
Trim62 C T 4: 128,902,553 T281I probably benign Het
Trip13 T C 13: 73,932,902 E115G probably benign Het
Trp63 A G 16: 25,802,087 T10A probably benign Het
Urah A T 7: 140,835,652 H11L probably damaging Het
Usp39 G A 6: 72,342,908 T109I probably damaging Het
Zfhx4 T G 3: 5,412,815 S3497A probably damaging Het
Zfp85 C T 13: 67,749,065 R296H probably benign Het
Other mutations in Wfikkn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00816:Wfikkn2 APN 11 94238095 nonsense probably null
R1269:Wfikkn2 UTSW 11 94238475 missense probably damaging 1.00
R1466:Wfikkn2 UTSW 11 94238895 missense probably damaging 1.00
R1466:Wfikkn2 UTSW 11 94238895 missense probably damaging 1.00
R1519:Wfikkn2 UTSW 11 94238107 missense probably benign 0.00
R1584:Wfikkn2 UTSW 11 94238895 missense probably damaging 1.00
R1856:Wfikkn2 UTSW 11 94238123 nonsense probably null
R2026:Wfikkn2 UTSW 11 94238953 missense possibly damaging 0.93
R2842:Wfikkn2 UTSW 11 94238259 missense probably benign 0.00
R4738:Wfikkn2 UTSW 11 94239076 missense probably benign 0.00
R4833:Wfikkn2 UTSW 11 94239052 missense probably benign 0.09
R5087:Wfikkn2 UTSW 11 94238347 missense probably damaging 1.00
R5775:Wfikkn2 UTSW 11 94238288 missense probably benign 0.22
R5966:Wfikkn2 UTSW 11 94238862 missense probably damaging 1.00
R6842:Wfikkn2 UTSW 11 94238040 missense probably damaging 0.96
R7539:Wfikkn2 UTSW 11 94242359 missense probably damaging 1.00
R7849:Wfikkn2 UTSW 11 94238984 missense probably benign 0.01
R7879:Wfikkn2 UTSW 11 94238929 missense probably damaging 1.00
R8299:Wfikkn2 UTSW 11 94239064 missense probably damaging 1.00
Z1176:Wfikkn2 UTSW 11 94237652 missense possibly damaging 0.62
Z1176:Wfikkn2 UTSW 11 94238401 missense not run
Predicted Primers PCR Primer
(F):5'- CCATGATGATGAGTGGTGTCTCAC -3'
(R):5'- AAGCTTATGTCCCACGCTGG -3'

Sequencing Primer
(F):5'- TCACCCACTGTCACGTTGGG -3'
(R):5'- CAGTCCTTCGTCTATGGCGG -3'
Posted On2019-10-17